Antibodies |
Rabbit polyclonal anti-GFP |
Chromotek |
Cat# PABG1; RRID:AB_2749857 |
Guinea pig polyclonal anti-SERT |
Synaptic Systems |
Cat# 340 004; RRID:AB_2620086 |
Mouse monoclonal anti-ADCY3 |
Encor Biotechnology |
Cat# MCA-1A12; RRID:AB_2744501 |
Rabbit anti-PCP4 |
Millipore Sigma |
Cat# HPA005792; RRID:AB_1855086 |
Chicken anti-rootletin |
Millipore Sigma |
Cat# ABN1686; RRID:AB_2893142 |
Rabbit anti-ADD1 |
Abcam |
Cat# ab40760; RRID:AB_722627 |
Rabbit anti-synaptophysin |
Cell Signaling |
Cat# 36406; RRID:AB_2799098 |
Rabbit anti-synaptophysin |
Thermo Fisher Scientific |
Cat# MA5-14532; RRID:AB_10983675 |
Rabbit anti-Trio GEFD2 |
Laboratory of Dr. Susanne Schmidt |
N/A |
Rabbit anti-h4k5ac |
Thermo Fisher Scientific |
Cat# MA5-32009; RRID:AB_2809303 |
Mouse anti-panh4ac |
Thermo Fisher Scientific |
Cat# MA3-066; RRID:AB_2633028 |
Rabbit anti-H3K27ac |
Abcam |
Cat# ab177178; RRID:AB_2828007 |
Alexa Fluor Plus 488 goat anti-rabbit |
Thermo Fisher Scientific |
Cat# A32731; RRID:AB_2633280 |
CF488A donkey anti-guinea pig |
Biotium |
Cat# 20169; RRID:AB_10853115 |
Alexa Fluor Plus 555 goat anti-rabbit |
Thermo Fisher Scientific |
Cat# A32732; RRID:AB_2633281 |
CF555 goat anti-mouse IgG1 |
Biotium |
Cat# 20247; RRID:AB_10854998 |
CF633 goat anti-mouse IgG1
|
Biotium |
Cat# 20250; RRID:AB_10852830 |
CF633 donkey anti-rabbit |
Biotium |
Cat# 20215; RRID:AB_10853935 |
Bacterial and virus strains |
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] |
HHMI Viral Tools |
N/A |
pAAV[flex_on]-CAG-Farnesylated-SNAPtag |
HHMI Viral Tools |
N/A |
pAAV-EF1a-DIO-hM3D(Gq)-mCherry |
HHMI Viral Tools |
N/A |
pAAV-TRE-HTR6-SNAP-TRIP |
HHMI Viral Tools |
N/A |
pAAV-SYN1-Tet3G |
HHMI Viral Tools |
N/A |
pAAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE |
Addgene |
Addgene viral prep # 51509-AAV1 |
Biological samples |
Hippocampal and raphe neuron culture |
In house |
N/A |
Chemicals, peptides, and recombinant proteins |
Tn5 transposase |
In house |
N/A |
PA-O-Ser |
This paper |
N/A |
SB 271046 hydrochloride |
Tocris |
Cat# 3368; CAS 209481-24-3 |
SB-258585 hydrochloride |
Caymen Chemicals |
Cat# 17416; CAS 1216468-02-8 |
WAY181187 oxalate |
Tocris |
Cat# 5589; CAS 1883548-85-3 |
H-89 hydrochloride |
Caymen Chemicals |
Cat# 10010556; CAS 130964-39-5 |
Hoechst 33342 |
Thermo Fisher Scientific |
Cat# 62249; CAS 875756-97-1 |
Deschloroclozapine |
Tocris |
Cat# 7193; CAS 1977-07-7 |
5-hydroxytrptamine (serotonin, 5-HT) |
Alfa Aesar |
Cat# B21263-06; CAS 153-98-0 |
Acetylcholine chloride |
Solarbio |
Cat# G8320; CAS 60-31-1 |
Adenosine |
Sigma-Aldrich |
Cat# A4036; CAS 58-61-7 |
Adenosine 5’-triphosphate (ATP) |
Sigma-Aldrich |
Cat# A7699; CAS 34369-07-8 |
Dopamine hydrochloride |
Sigma-Aldrich |
Cat# H8502; CAS 62-31-7 |
γ-Aminobutyric acid (GABA) |
Tocris |
Cat# 0344; CAS 56-12-2 |
L-Glutamic acid |
Sigma-Aldrich |
Cat# V900408; CAS 56-86-0 |
Glycine |
Sigma-Aldrich |
Cat# G7403; CAS 56-40-6 |
Histamine dihydrochloride |
Tocris |
Cat# 3545; CAS 56-92-8 |
Melatonin |
Sigma-Aldrich |
Cat# M5250; CAS 73-31-4 |
Norepinephrine bitartrate |
Tocris |
Cat# 5169; CAS 51-40-1 |
Octopamine hydrochloride |
Abcam |
Cat# ab120770; CAS 770-05-8 |
Tyramine |
Aladdin |
Cat# T105543; CAS 51-67-2 |
L-Tryptophan |
Sigma-Aldrich |
Cat# 93659; CAS 73-22-3 |
Critical commercial assays |
Alexa Fluor™ 488 Tyramide SuperBoost™ Kit, goat anti-rabbit IgG |
Thermo Fisher Scientific |
Cat# B40922
|
Experimental models: Cell lines |
hTERT RPE-1 |
ATCC |
CRL-4000 |
HEK293A |
Laboratory of Dr. Asuka Inoue, https://doi.org/10.1038/ncomms10156
|
N/A |
HEK293A GNAQ/11 KO |
Laboratory of Dr. Asuka Inoue, https://doi.org/10.1038/ncomms10156
|
N/A |
HEK293T |
ATCC |
1573 |
Experimental models: Organisms/strains |
Mouse: C56BL/6 |
Charles River |
Cat# 027; RRID:IMSR_CRL:027 |
Mouse: C57BL/6J |
Jackson Laboratory |
Cat# 000664; IMSR_JAX:000664 |
Mouse: Htr6 KO |
This paper |
N/A |
Mouse Htr6-EGFP knock-in |
Laboratory of Dr. Séverine Chaumont-Dubel, https://doi.org/10.1073/pnas.1600914113
|
N/A |
Oligonucleotides |
[phos]CTGTCTCTTATACACATCT |
Chen et al., 2016
|
N/A |
/ATTO594/TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
Chen et al., 2016
|
N/A |
/ATTO594/GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG |
Chen et al., 2016
|
N/A |
Recombinant DNA |
HTR6-Tango |
Kroeze et al., 2015
|
Addgene 66414 |
Tet-On HTR6-RhoA sensor |
This paper |
N/A |
Tet-On Arl13b-RhoA sensor |
This paper |
N/A |
Tph2-Cre |
This paper |
N/A |
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato |
Klapoetke et al., 2014
|
Addgene 62723 |
pAAV[flex_on]-CAG-Farnesylated-SNAPtag |
This paper |
N/A |
pAAV-FLEX-tdTomato |
Unpublished; Laboratory of Ed Boyden |
Addgene 28306 |
pAAV-EF1a-DIO-hM3D(Gq)-mCherry |
Unpublished; Laboratory of Dr. Bryan Roth. |
Addgene 50460 |
pAAV-TRE-HTR6-SNAP-TRIP |
This paper |
N/A |
pAAV-SYN1-Tet3G |
This paper |
N/A |
Tet-On GRAB-HTR6-cilia:3xGGGGS:Halo tag |
This paper |
N/A |
GRAB-HTR6-PM |
This paper |
N/A |
Hyperactive piggybac transposase |
VectorBuilder |
N/A |
Software and algorithms |
ImageJ/Fiji |
Schindelin et al., 2012
|
https://imagej.net/software/fiji/
|
Prism v9.2 |
Graphpad Software |
https://www.graphpad.com
|
MATLAB 2020b, 2021a |
The MathWorks |
https://www.mathworks.com/
|
Python 3.8 (Anaconda) |
Anaconda |
https://www.anaconda.com/
|
DABEST |
Ho et al., 2019
|
https://acclab.github.io/DABEST-python-docs/index.html
|
OrientationJ |
Püspöki et al., 2016; Rezakhaniha et al., 2012
|
https://github.com/Biomedical-Imaging-Group/OrientationJ
|
VAST Lite |
Berger et al., 2018
|
https://lichtman.rc.fas.harvard.edu/vast/
|
3ds Max 2021 |
Autodesk |
https://www.autodesk.com/products/3ds-max/overview
|
Mlextend |
Raschka, 2018
|
http://rasbt.github.io/mlxtend/
|