Table 2.
Oligonucleotide primers for targeted genes and their PCR amplicon sizes
| Target gene (encoding protein) | Primer* | Direction | Sequence (5´→ 3´) (length, k-mer) | Tm (°C)† | Expected amplicon size |
|---|---|---|---|---|---|
| cdtA | Pc_cdtA_F | Forward | TCAGCAGATGTGTAATTGTCCTC (23) | 54 | 693 bp |
| (cytolethal distending toxin A) | Pc_cdtA_R | Reverse | ATCGCAGTCGCATTTAATAGC (21) | 54 | |
| cdtB | Pc_cdtB_F | Forward | TCCAAGAGGCGGGTACTTTG (20) | 54 | 582 bp |
| (cytolethal distending toxin B) | Pc_cdtB_R | Reverse | AACTGGCACCAATACGCTCA (20) | 54 | |
| cdtC | Pc_cdtC_F | Forward | GAGTTATCACCACCTCCACGT (21) | 53 | 433 bp |
| (cytolethal distending toxin C) | Pc_cdtC_R | Reverse | GCGGTACTAAAATTTTACTTGGTCCA (26) | 55 |
*The same primers were used for both the PCR amplification and direct sequencing; †Tm values were calculated using the nearest-neighbor method.
Abbreviation: Tm, melting temperature.