REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Anti-mouse CD4-PerCP-Cy5.5 (clone: RM4-5) | TONBO biosciences | Cat# 65-0042-U100; RRID: AB_2621876 |
Anti-mouse CD8a-PerCP-Cy5.5 (clone: 53-6.7) | TONBO biosciences | Cat# 65-0081-U100; RRID: AB_2621882 |
Anti-mouse B220-PerCP-Cy5.5 (clone: RA3-6B2) | TONBO biosciences | Cat# 65-0452-U100; RRID: AB_2621892 |
Anti-mouse B220-APC (clone: RA3-6B2) | BioLegend | Cat# 103212; RRID: AB_312997 |
Anti-mouse Ter-119-PerCP-Cy5.5 (clone: TER-119) | TONBO biosciences | Cat# 65-5921-U100 |
Anti-mouse Gr1 (Ly-6G/6C)-PerCP-Cy5.5 (clone: RB6-8C5) | BioLegend | Cat# 108428; RRID: AB_893558 |
Anti-mouse Gr1-PE-Cy7 (clone: RB6-8C5) | TONBO biosciences | Cat# 60-5931-U100; RRID: AB_2621870 |
Anti-mouse Mac1 (CD11b)-PerCP-Cy5.5 (clone: M1/70) | TONBO biosciences | Cat# 65-0112-U100; RRID: AB_2621885 |
Anti-mouse Mac1-PE-Cy7 (clone: M1/70) | TONBO biosciences | Cat# 60-0112-U100; RRID: AB_2621836 |
Anti-mouse CD45.1-PE (clone: A20) | BD biosciences | Cat# 553776; RRID: AB_395044 |
Anti-mouse CD45.2-BV421 (clone: 104) | BD biosciences | Cat# 562895; RRID: AB_2737873 |
Anti-mouse CD45.2-Alexa Four 700 (clone: 104) | BioLegend | Cat# 109822; RRID: AB_493731 |
Anti-mouse Sca-1 (Ly-6A/E)-PE-Cy7 (clone: E13-161.7) | BioLegend | Cat# 122514; RRID: AB_756199 |
Anti-mouse Sca-1-Alexa488 (clone: E13-161.7) | BioLegend | Cat# 122516; RRID: AB_756201 |
Anti-mouse Sca-1-BV785 (clone: D7) | BioLegend | Cat# 108139; RRID AB_2565957 |
Anti-mouse c-Kit (CD117)-APC-Cy7 (clone: 2B8) | BioLegend | Cat# 105826; RRID: AB_1626278 |
CD117 MicroBeads Mouse | Miltenyi Biotec | Cat# 130-091-224 |
Anti-mouse CD150-PE (clone: TC15-12F12.2) | BioLegend | Cat# 115904; RRID: AB_313683 |
Anti-mouse CD150-BV421 (clone: TC15-12F12.2) | BioLegend | Cat# 115926; RRID: AB_2562190 |
Anti-mouse CD150-BV785 (clone: TC15-12F12.2) | BioLegend | Cat# 115937; RRID: AB_2565962 |
Anti-mouse CD48-FITC (clone: HM48-1) | BioLegend | Cat# 103404; RRID: AB_313019 |
Anti-mouse CD48-PE (clone: HM48-1) | BioLegend | Cat# 103406; RRID: AB_313021 |
Anti-mouse CD48-APC (clone: HM48-1) | BioLegend | Cat# 103412; RRID: AB_571997 |
Anti-mouse CD48-BV510 (clone: HM48-1) | BD biosciences | Cat# 563536; RRID: AB_2738266 |
Anti-mouse CD48-Biotin (clone: HM48-1) | BioLegend | Cat# 103410; RRID: AB_528827 |
Fc-block (anti-mouse CD16/32) (clone: 2.4-G2) | BD biosciences | Cat# 553142; RRID: AB_394657 |
Anti-mouse CD16/32-BV510 (clone: 2.4G2) | BD biosciences | Cat# 740111; RRID: AB_2739869 |
Anti-mouse CD16/32- PE (clone: 93) | BioLegend | Cat# 101307; RRID: AB_312807 |
Anti-mouse CD16/32- Alexa700 (clone: A93) | Thermo Fisher Scientific | Cat# 56-4321-80; RRID: AB_493994 |
Anti-mouse CD34-FITC (clone: RAM34) | BD biosciences | Cat# 562608; RRID: AB_11154576 |
Anti-mouse CD34-BV421 (clone: MEC14.7) | BioLegend | Cat# 119321; RRID: AB_10900980 |
Anti-mouse Flt3 (CD135)-APC (clone: A2F10) | BioLegend | Cat# 135310; RRID: AB_2107050 |
Anti-mouse CD201 (EPCR)-PE (clone: RCR-16) | BioLegend | Cat# 141504; RRID: AB_10895909 |
Anti-mouse CD45-FITC (clone: 30-F11) | BD biosciences | Cat# 553080; RRID: AB_394609 |
Anti-mouse CD45-PE (clone: 30-F11) | BioLegend | Cat# 103134; RRID: AB_2562559 |
Anti-mouse CD45-BV421 (clone: 30-F11) | BioLegend | Cat# 103134; RRID: AB_2562559 |
Anti-mouse CD45-BV786 (clone: 30-F11) | BD biosciences | Cat# 564225; RRID: AB_2716861 |
Anti-mouse CD45-Biotin (clone: 30-F11) | BioLegend | Cat# 103104; RRID: AB_312969 |
Anti-Streptavidin-Alexa Fluor 555 (clone: TER-119) | Thermo Fisher Scientific | Cat# S21381; RRID: AB_2307336 |
CD34 MicroBeads Human | Miltenyi Biotec | Cat# 130-046-702 |
Anti-human CD34-FITC (clone: 581) | BD Bioscience | Cat# 560942; RRID: AB_396150 |
Anti-human CD34-APC (clone: 561) | BioLegend | Cat# 343607; RRID: AB_2074356 |
Anti-human CD38-PerCP-Cy5.5 (clone: HIT2) | BD Bioscience | Cat# 551400; RRID: AB_394184 |
Anti-human CD45RA-PE (clone: HI100) | BD Bioscience | Cat# 555489; RRID: AB_395880 |
Anti-human CD90-PE-Cy7 (clone: 5E10) | BioLengend | Cat# 328123; RRID: AB_2561692 |
Anti-human CD201 (EPCR)-BV421 (clone: RCR-252) | BD Bioscience | Cat# 743552; RRID: AB_2741576 |
Anti-human CD201 (EPCR)-PE (clone: RCR-401) | BioLegend | Cat# 351903; RRID: AB_10897801 |
Anti-human CD45-PE (clone: 2D1) | BioLegend | Cat # 368510; RRID: AB_2566370 |
Anti-mouse Ki67-eFlour660 (clone: SolA15) | eBioscience | Cat# 50-5698-82; RRID: AB_2574235 |
Anti-mouse/human Ki67-FITC (clone: 11F6) | BioLegend | Cat# 151212; RRID: AB_2814055 |
Annexin V-APC | BioLegend | Cat# 640920; RRID: AB_2561515 |
Chemicals, peptides, and recombinant proteins | ||
PBS | Nacalai Tesque | Cat# 14249-24 |
SF-O3 | SEKISUI MEDICAL | SS1303 |
DMEM/Ham’s-F12 medium | Nacalai Tesque | Cat# 11581-15 |
RPMI1640 | Nacalai Tesque | Cat# 30263-95 |
StemSpan SFEM | STEMCELL Technologies | Cat# 09650 |
HemEX-Type9A | Cell Science & Technology Institute | Cat# A5P00P01C |
MethoCult GF M3434 | STEMCELL Technologies | Cat# 03444 |
MethoCult H4434 | STEMCELL Technologies | Cat# 04434 |
Insulin-Transferrin-Selenium-Ethanolamine (ISTX) 1000x | Thermo Fisher Scientific | Cat# 51500-056 |
2-mercapto ethanol (2-ME) 1000x | Thermo Fisher Scientific | Cat# 21985-023 |
Penicillin | Meiji Seika | PGLD755 |
Streptomycin sulfate | Meiji Seika | SSDN1013 |
Fetal bovine serum | Thermo Fisher Scientific | Cat# 10270-106 |
Bovine serum albumin | Sigma Aldrich | Cat# A4503-100G |
Palmitic acid | Wako Pure Chemical Corporation | Cat# 165-00102 |
Oleic acid | Sigma Aldrich | Cat# O1383-1G |
Cholesterol | Sigma Aldrich | Cat# C3045-5G |
Sodium Hydroxide | Wako Pure Chemical Corporation | Cat# 191-01665 |
Recombinant Murine SCF | PeproTech | Cat# 250-03 |
Recombinant Human TPO | PeproTech | Cat# 300-18 |
Recombinant Murine G-CSF | PeproTech | Cat# 250-05 |
Recombinant Human SCF | PeproTech | Cat# 250-31L |
Recombinant Human FLT3L | PeproTech | Cat# 300-19 |
Recombinant Human IL-3 | PeproTech | Cat# 200-03 |
Recombinant Human IL-6 | PeproTech | Cat# 200-06 |
DMSO | Sigma Aldrich | Cat# D8418 |
UM171 | Selleck | Cat# 7608 |
Lymphoprep | STEMCELL Technologies | Cat# 07811 |
BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit | Thermo Fisher Scientific | Cat# BDB554714 |
5-ethynyl-2′-deoxyuridine (EdU) | Tokyo Chemical industry | Cat# E1057 |
Tris-hydroxypropyltriazolymethylamine (THPTA) | Click Chemistry Tools | Cat# 1010 |
AFDye 647 Picolyl Azide | Click Chemistry Tools | Cat# 1300-1 |
Copper (Brenet et al.)75 Sulfate Pentahydrate | Tokyo Chemical Industry Co., Ltd. | Cat# 7758-99-8 |
Ascorbic acid | Tokyo Chemical Industry Co., Ltd. | Cat# 03428-72 |
Click-iT Plus EdU Alexa Flour 647 Flow Cytometry Assay Kit | Thermo Fisher Scientific | Cat# C10634 |
Propidium iodide | Lifetechnologies | Cat# P3566 |
Hoechst 33342 | Thermo Fisher Scientific | Cat# H3570 |
TrueCut Cas9 Protein v2 | Thermo Fisher Scientific | Cat# A36299 |
Flow-Check Fluorospheres | Beckman Coulter | Cat# 7547053 |
SuperSignal West Femto Maximum Sensitivity Substrate | Thermo Fisher Scientific | Cat# 34094 |
Critical commercial assays | ||
Neon Transfection System 10μL Kit | Thermo Fisher Scientific | Cat# MPK1096 |
CUGA7 sgRNA Synthesis Kit | Nippon Gene | Cat# 314-08691 |
TaKaRa Ex Taq | Takara Bio Inc | Cat# RR001A |
Q5 High-Fidelity 2x Master Mix | New England BioLabs | Cat# M0492S |
NucleoSpin Tissue XS | Macherey Nagel | Cat# 740901.50 |
Wizard SV Gel and PCR Clean-Up System | Promega | Cat# A9282 |
Annexin V-PE Apoptosis Detection Kit | BD Biosciences | Cat# 559763 |
RNeasy Mini Kit | QIAGEN | Cat# 74136 |
SuperScript VILO cDNA Synthesis Kit | Thermo Fisher Scientific | Cat# 11754050 |
TB Green Premix Ex Taq II | Takara Bio | Cat# RR820D |
AAVpro Purification Kit | Takara Bio | Cat# 6666 |
AAV Helper Free Expression System | Cell Biolabs., Inc | Cat# VPK-402 |
Deposited data | ||
RNA-seq | This paper | DNA Data Bank of Japan (DDBJ): Accession #DRA014998 |
Experimental models: Organisms/strains | ||
Mouse: C57BL/6JJmsSlc | Japan SLC, Inc. | http://www.jslc.co.jp/english/index2.htm |
Mouse: C57BL/6J-Ly5.1 | CLEA Japan, Inc | N/A |
Mouse: C57BL/6-Tg(Ubc-GFP)30Scha/J | The Jackson Laboratory | JAX stock #004353 |
Mouse: Evi1-IRES-GFP mice | Kataoka et al.70 | N/A |
Oligonucleotides | ||
sgRNA Common primer: AAAAGCACCGACTCGGTGCC | This paper | N/A |
sgRNA Reversed primer: AAAAGCACCGACTCGGTGCCA CTTTTTCAAGTTGATAACGGAC TAGCCTTATTTTAACTTGCT ATT TCTAGCTCTAAAAC |
This paper | N/A |
Rosa sgRNA target Forward primer: ttaatacgactcactataggACTCCAGTCT TTCTAGAAGAgttttagagctagaaatagc |
Chu et al.60 | N/A |
Mouse CD45 sgRNA target Forward primer: ttaatacgactcactataGGGTTTGTGGCTCAAA CTTCgttttagagctagaaatagc |
This paper | N/A |
GFP sgRNA target Forward primer: ttaatacgactcactataGGGCGAGGAGCTGTT CACCGgttttagagctagaaatagc |
Gundry et al.35 | |
Rosa forward primer: CCAAAGTCGCTCTGAGTTGTTATCAGT | This paper | N/A |
Rosa reverse primer: GGAGCGGGAGAAATGGATATGAAG |
This paper | N/A |
Rosa sequence primer: ACATAGTCTAACTCGCGACAC |
This paper | N/A |
Mouse CD45 forward primer: AGAAGCCATTGCACTGACTTTG |
This paper | N/A |
Mouse CD45 reverse primer: GTGTGATCTTTCCCCGAAACAT |
This paper | N/A |
Mouse CD45 sequence primer: CTGCAAAGAGGACCCTTTACAGT |
This paper | N/A |
Ubc-GFP forward primer: GTTCACCTTGATGCCGTTCT |
This paper | N/A |
Ubc-GFP reverse and sequence primer: CACCCGTTCTGTTGGCTTAT | This paper | N/A |
Rosa sgRNA: ACUCCAGUCUUUCUAG AAGA |
Synthego Chu et al.60 |
N/A |
Mouse CD45 sgRNA: GGGUUUGUGGCU CAAACUUC |
Synthego | N/A |
AAVS1 sgRNA: GGGGCCACUAGGGA CAGGAU |
Synthego Bak et al.37 |
N/A |
Human CD45 sgRNA: GGUGCUGGUGUUGGGCGCAC | Synthego Gundry et al.35 |
N/A |
GFP sgRNA: GGGCGAGGAGCU GUUCACCG |
Synthego Gundry et al.35 |
N/A |
Alt-R CRISPR-Cas9 crRNA XT for CD45: GGGTTTGTGGCTCAAACTTC |
IDT | N/A |
Alt-R CRISPR-Cas9 tracRNA | IDT | N/A |
Alt-R CRISPR-Cas9 tracRNA ATTO | IDT | N/A |
AAV LHA in-out forward primer (Rosa genome): CTCTGGGGGAGTCGTTTTACC | This paper | N/A |
AAV LHA in-out reverse primer (CAG promoter): CCAGGCGGGCCATTTACC | This paper | N/A |
AAV RHA in-out forward primer (EGFP): AACGA GAAGCGCGATCACAT |
This paper | N/A |
AAV RHA in-out reverse primer (Rosa genome): ACAGCCTCGATTTGTGGTGT | This paper | N/A |
AAV titration qPCR forward primer: GGAACCCCTAGTGATGGAGTT | Aurnhammer et al.83 | N/A |
AAV titration qPCR reverse primer: CGGCCTCAGTGAGCGA | Aurnhammer et al.83 | N/A |
Infb1 qPCR forward primer: CCTGGAGCAGCTGAATGGAA | Takara Bio | N/A |
Infb1 qPCR reverse primer: TGGATGGCAAAGGCAGTGAA | Takara Bio | N/A |
Oas2 qPCR forward primer: GGCCTGGTACAGCCTTGGAA | Takara Bio | N/A |
Oas2 qPCR reverse primer: AGTCTTTGCCAGATCACTCCAGAA | Takara Bio | N/A |
Ddx58 (RIG-I) qPCR forward primer: AGCCAAGGATGTCTCCGAGGAA | Liu et al.84 | N/A |
Ddx58 (RIG-I) qPCR reverse primer: ACACTGAGCACGCTTTGTGGAC | Liu et al.84 | N/A |
Isg15 qPCR forward primer: CATCCTGGTGAGGAACGAAAGG | Liu et al.84 | N/A |
Isg15 qPCR reverse primer: CTCAGCCAGAACTGGTCTTCGT | Liu et al.84 | N/A |
β-actin qPCR forward primer: CATCCGTAAAGACCTCTATGCCAAC | Takara Bio | N/A |
β-actin qPCR reverse primer: ATGGAGCCACCGATCCACA | Takara Bio | N/A |
Software and algorithms | ||
FlowJo version 10.7.2 | Tree Star | https://www.flowjo.com/solutions/flowjo |
SnapGene | GLS Biotech | https://www.snapgene.com/ |
Molecular Biology tool | Benchling | https://www.benchling.com |
TIDE | Brinkman et al.85 | https://tide.nki.nl |
Prism v7 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
Imaris 9.8.2 | Oxford Instruments | https://imaris.oxinst.com/support/imaris-release-notes/9-8-0 |
ImageJ | National Institutes of Health | https://imagej.nih.gov/ij/ |
R v.4.1.0 | R Development Core Team (2008) | http://www.r-project.org |
DESeq2 | Love et al.86 | http://bioconductor.org/packages/release/bioc/html/DESeq2.html |
fGSEA | Korotkevich et al.87 | http://bioconductor.org/packages/release/bioc/html/fgsea.html |
GSVA | Hanzelmann et al.88 | http://bioconductor.org/packages/release/bioc/html/GSVA.html |
Others | ||
Neon Transfection System | Thermo Fisher Scientific | Cat# MPK5000 |
Neon Transfection System 10μL Kit | Thermo Fisher Scientific | Cat# MPK1096 |
Nucleofector 2b | Lonza | AAB-1001 |
Human CD34+ Cell Nucleofector Kit | Lonza | PVA-1003 |
NanoDrop Onec Microvolume UV-Vis Spectrophotometer | Thermo Fisher Scientific | Cat# ND-ONEC-W |
Hiseq1500 | Illumina |