Skip to main content
. 2023 Jan;29(1):145–148. doi: 10.3201/eid2901.220283

Table 1. Primer/probe sets for detection of Bourbon virus RNA in New York, NY, USA*.

Name Gene target Sequence, 5′ → 3′
BRBV F† Polymerase subunit, PB1 AACCGGCCAATAGGG
BRBV R Polymerase subunit, PB1 TGCCAGTTGGGTAGC
BRBV PROBE_5Cy5 /5Cy5/ATGGAGCTG/TAO/CTTTCACTACC/3IAbRQSp/
Bourbon_virus_F1‡ Polymerase subunit, PB1 ATTGCTACTCCGTCCATGTTAGTAAG
Bourbon_virus_R1 Polymerase subunit, PB1 CCAGAACTTGGTAGACATTCCAATAAG
Bourbon_virus_P1_HEX probe /5HEX/CCCTTGCTG/ZEN/CATCTTCCACCACTTTCACAA/3IABkFQ/

*BRBV, Bourbon virus; F, forward; P, probe; PB1, polymerase basic 1; R, reverse. †Primer/probe set developed at Wadsworth Center, New York State Department of Health, based on Bourbon virus (St. Louis strain) (GenBank accession no. MK453528). ‡Primer/probe set developed at TickReport (https://www.tickreport) based on Bourbon virus (original strain) (GenBank accession no. KU708254)