Skip to main content
. 2022 Dec 13;11:e84694. doi: 10.7554/eLife.84694

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Cell line (Spodoptera frugiperda) Sf9 insect cells Thermo Fisher Scientific 12659017
Cell line (Spodoptera frugiperda) Sf9 insect cells Thermo Fisher Scientific B825-01
Cell line (Trichoplusia ni) High Five insect cells Thermo Fisher Scientific B85502
Strain, strain background (Escherichia coli) MAX Efficiency DH10bac Competent Cells Thermo Fisher Scientific 10361012
Biological sample (Xenopus laevis) Xenopus laevis eggs Hamamatsu Seibutsu-Kyozai RRID:NXR_0031 Female, adult frogs
Biological sample (Mus musculus) Mus musculus sperm nuclei Mus musculus cauda epididymis (BALB/c×C57BL/6J)F1; Shintomi et al., 2017 N/A Male, adult mice
Antibody anti-XSMC4 (rabbit polyclonal) Hirano and Mitchison, 1994 In-house: AfR8L WB (2 μg/ml)
Antibody anti-XSMC2 (rabbit polyclonal) Hirano and Mitchison, 1994 In-house: AfR9-6 WB (1 μg/ml)
Antibody anti-XSMC2 (rabbit polyclonal, biotin-labeled) Hirano and Mitchison, 1994 In-house: AfR9 IF (1 μg/ml)
Antibody anti-XCAP-D2 (rabbit polyclonal) Hirano et al., 1997 In-house: AfR16L WB (1 μg/ml)
Antibody anti-XCAP-G (rabbit polyclonal) Hirano et al., 1997 In-house: AfR11-3L WB (1 μg/ml)
Antibody anti-XCAP-H (rabbit polyclonal) Hirano et al., 1997 In-house: AfR18 WB (0.7 μg/ml)
Antibody anti-XCAP-D3 (rabbit polyclonal) Ono et al., 2003 In-house: AfR196-2L WB (1 μg/ml)
Antibody anti-mSMC4 (rabbit polyclonal) Lee et al., 2011 In-house: AfR326-3L WB (1 μg/ml); IF (1 μg/ml)
Antibody anti-mSMC2 (rabbit polyclonal) Lee et al., 2011 In-house: AfR329-4L WB (1 μg/ml)
Antibody anti-hCAP-D2 (rabbit polyclonal) Kimura et al., 2001 In-house: AfR51-3 WB (1 μg/ml)
Antibody anti-hCAP-G (rabbit polyclonal) Kimura et al., 2001 In-house: AfR55-4 WB (1 μg/ml); IP (refer to Materials and methods)
Antibody anti-hCAP-H (rabbit polyclonal) Kimura et al., 2001 In-house: AfR57-4 WB (1 μg/ml)
Antibody anti-XTopo IIa (rabbit antiserum) Hirano and Mitchison, 1993 In-house: αC1-6 WB (1/2000)
Antibody anti-hCAP-H pS17 (hHP1) (rabbit polyclonal) This paper; custom ordered from SIGMA Genosys In-house: AfR464-3P WB (1 μg/ml)
Antibody anti-hCAP-H pS76 (hHP2) (rabbit polyclonal) This paper; custom ordered from SIGMA Genosys In-house: AfR470-3P WB (1 μg/ml)
Antibody anti-hCAP-D2 pT1339 (hDP1) (rabbit polyclonal) This paper In-house: AfR173-4P WB (1 μg/ml)
Antibody anti-hCAP-D2 pT1384 (hDP2) (rabbit polyclonal) This paper In-house: AfR175-4P WB (1 μg/ml)
Antibody anti-hCAP-D2 pT1389 (hDP3) (rabbit polyclonal) This paper In-house: AfR177-4P WB (1 μg/ml)
Antibody Alexa Fluor 568-conjugated anti-rabbit IgG Thermo Fisher Scientific A11036 [RRID: AB_10563566] IF (1/500)
Antibody Horseradish peroxidase-conjugated anti-rabbit IgG Vector Laboratories PI-1000 [RRID: AB_2336198] WB (1/10,000)
Peptide, recombinant protein hHP1 This paper; custom ordered from SIGMA Genosys [C]PHSASpSPSERV
Peptide, recombinant protein hHP2 This paper; custom ordered from SIGMA Genosys [C]PRLLApSPSSRS
Peptide, recombinant protein Precission Protease Cytiva 27-0843-01 Used in purification of recombinant condensin I;
Kinoshita et al., 2022
Peptide, recombinant protein Benzonase nuclease Novagen 71205 Used in purification of recombinant condensin I;
Kinoshita et al., 2022
Peptide, recombinant protein λ Protein Phosphatase New England Biolabs P0753S
Peptide, recombinant protein Nt.BspQI nicking endonuclease New England Biolabs R0644S
Peptide, recombinant protein EcoRI restriction enzyme TaKaRa Bio 1040A
Peptide, recombinant protein Serotropin (PMSG) ASKA Pharmaceutical Co, Ltd Used in preparation of HSS;
Shintomi and Hirano, 2018
Peptide, recombinant protein Gonatropin (HCG) ASKA Pharmaceutical Co, Ltd Used in preparation of HSS;
Shintomi and Hirano, 2018
Recombinant DNA reagent pUC19 Genbank: L9137 RRID: Addgene_50005
Recombinant DNA reagent λDNA New England Biolabs N3011S
Sequence-based reagent hCAP-H (CH) deletion-F This paper Forward primer GAACGACTTCTCTACCGACTCTCCC
Sequence-based reagent hCAP-H (CH) deletion-R This paper Reverse primer GTAGAGAAGTCGTTCTGAGGGAAGTC
Sequence-based reagent hCAP-H (WT and dN) forward This paper Forward primer GAAGCGCGCGGAATTCGCCA
Sequence-based reagent hCAP-H (WT) reverse This paper Reverse primer GAAGTACAGGTCCTCAGTGGTAGGTT
CCAGGTCGCCCTGCCTAACTAA
Sequence-based reagent hCAP-H (dN) reverse This paper Reverse primer GAAGTACAGGTCCTCAGTGGTAGGTT
CCAGGTCGCCCTGCCTGACTAA
Sequence-based reagent HaloTag forward This paper Forward primer GAGGACCTGTACTTCCAGTCTGACAAC
GACATGGCCGAAATCGGAACT
Sequence-based reagent HaloTag reverse This paper Reverse primer AGCGGCCGCGACTAGTTTATC
CGCTGATTTCCAGGGTA
Commercial assay or kit PrimeSTAR Mutagenesis Basal Kit TaKaRa Bio R046A
Commercial assay or kit In-Fusion HD Cloning Kit TaKaRa Bio 639650
Commercial assay or kit Nucleobond PC100 MACHERREY-NAGEL GmbH & Co KG 740573.100
Chemical compound, drug Cytochalasin D Sigma-Aldrich C8273 Used in preparation of HSS;
Shintomi and Hirano, 2018
Chemical compound, drug ATP Sigma-Aldrich A2383
Chemical compound, drug AMP-PNP Jena Bioscience NU-407
Software, algorithm UNICORN7 Cytiva
Software, algorithm Prism 8 GraphPad
Software, algorithm Olympus cellSens Dimensions Olympus
Software, algorithm Excel Microsoft
Software, algorithm Photoshop Adobe
Software, algorithm ImageJ https://imagej.nih.gov/ij
Other Immobilon Western Chemiluminescent HRP Substrate Millipore WBKLS500 Used detection of immunoblots
Other Alexa Fluor 488-conjugated streptavidin Thermo Fisher Scientific S11223 IF (1/500)
Other Streptavidin Merck S4762 1 mg/ml (Loop extrusion assay)
Other HaloTag Alexa Fluor 488 Ligand Promega G1001
Other PD-10 column Cytiva 17-0851-01
Other Dynabeads Protein A Thermo Fisher Scientific 10002D For immunodepletion with HSS and immunoprecipitation in topological loading assay
Other rProtein A Sepharose Fast Flow Cytiva 17-1279-01 For immunoprecipitation with HSS
Other Glutathione Sepharose 4B Cytiva 17075601 Used in purification of recombinant condensin I; Kinoshita et al., 2022
Other HiTrap Q HP 1 ml Cytiva 17115301 Used in purification of recombinant condensin I; Kinoshita et al., 2022
Other Amicon Ultra-15 Millipore UFC905024 Used in ultrafiltration of purified condensin I; Kinoshita et al., 2022
Other DAPI Roche 10236276001 IF (2 μg/ml)
Other GelRed Biotium 41003
Other Sytox Orange Thermo Fisher Scientific S11368