Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Spodoptera frugiperda) | Sf9 insect cells | Thermo Fisher Scientific | 12659017 | |
| Cell line (Spodoptera frugiperda) | Sf9 insect cells | Thermo Fisher Scientific | B825-01 | |
| Cell line (Trichoplusia ni) | High Five insect cells | Thermo Fisher Scientific | B85502 | |
| Strain, strain background (Escherichia coli) | MAX Efficiency DH10bac Competent Cells | Thermo Fisher Scientific | 10361012 | |
| Biological sample (Xenopus laevis) | Xenopus laevis eggs | Hamamatsu Seibutsu-Kyozai | RRID:NXR_0031 | Female, adult frogs |
| Biological sample (Mus musculus) | Mus musculus sperm nuclei | Mus musculus cauda epididymis (BALB/c×C57BL/6J)F1; Shintomi et al., 2017 | N/A | Male, adult mice |
| Antibody | anti-XSMC4 (rabbit polyclonal) | Hirano and Mitchison, 1994 | In-house: AfR8L | WB (2 μg/ml) |
| Antibody | anti-XSMC2 (rabbit polyclonal) | Hirano and Mitchison, 1994 | In-house: AfR9-6 | WB (1 μg/ml) |
| Antibody | anti-XSMC2 (rabbit polyclonal, biotin-labeled) | Hirano and Mitchison, 1994 | In-house: AfR9 | IF (1 μg/ml) |
| Antibody | anti-XCAP-D2 (rabbit polyclonal) | Hirano et al., 1997 | In-house: AfR16L | WB (1 μg/ml) |
| Antibody | anti-XCAP-G (rabbit polyclonal) | Hirano et al., 1997 | In-house: AfR11-3L | WB (1 μg/ml) |
| Antibody | anti-XCAP-H (rabbit polyclonal) | Hirano et al., 1997 | In-house: AfR18 | WB (0.7 μg/ml) |
| Antibody | anti-XCAP-D3 (rabbit polyclonal) | Ono et al., 2003 | In-house: AfR196-2L | WB (1 μg/ml) |
| Antibody | anti-mSMC4 (rabbit polyclonal) | Lee et al., 2011 | In-house: AfR326-3L | WB (1 μg/ml); IF (1 μg/ml) |
| Antibody | anti-mSMC2 (rabbit polyclonal) | Lee et al., 2011 | In-house: AfR329-4L | WB (1 μg/ml) |
| Antibody | anti-hCAP-D2 (rabbit polyclonal) | Kimura et al., 2001 | In-house: AfR51-3 | WB (1 μg/ml) |
| Antibody | anti-hCAP-G (rabbit polyclonal) | Kimura et al., 2001 | In-house: AfR55-4 | WB (1 μg/ml); IP (refer to Materials and methods) |
| Antibody | anti-hCAP-H (rabbit polyclonal) | Kimura et al., 2001 | In-house: AfR57-4 | WB (1 μg/ml) |
| Antibody | anti-XTopo IIa (rabbit antiserum) | Hirano and Mitchison, 1993 | In-house: αC1-6 | WB (1/2000) |
| Antibody | anti-hCAP-H pS17 (hHP1) (rabbit polyclonal) | This paper; custom ordered from SIGMA Genosys | In-house: AfR464-3P | WB (1 μg/ml) |
| Antibody | anti-hCAP-H pS76 (hHP2) (rabbit polyclonal) | This paper; custom ordered from SIGMA Genosys | In-house: AfR470-3P | WB (1 μg/ml) |
| Antibody | anti-hCAP-D2 pT1339 (hDP1) (rabbit polyclonal) | This paper | In-house: AfR173-4P | WB (1 μg/ml) |
| Antibody | anti-hCAP-D2 pT1384 (hDP2) (rabbit polyclonal) | This paper | In-house: AfR175-4P | WB (1 μg/ml) |
| Antibody | anti-hCAP-D2 pT1389 (hDP3) (rabbit polyclonal) | This paper | In-house: AfR177-4P | WB (1 μg/ml) |
| Antibody | Alexa Fluor 568-conjugated anti-rabbit IgG | Thermo Fisher Scientific | A11036 [RRID: AB_10563566] | IF (1/500) |
| Antibody | Horseradish peroxidase-conjugated anti-rabbit IgG | Vector Laboratories | PI-1000 [RRID: AB_2336198] | WB (1/10,000) |
| Peptide, recombinant protein | hHP1 | This paper; custom ordered from SIGMA Genosys | [C]PHSASpSPSERV | |
| Peptide, recombinant protein | hHP2 | This paper; custom ordered from SIGMA Genosys | [C]PRLLApSPSSRS | |
| Peptide, recombinant protein | Precission Protease | Cytiva | 27-0843-01 | Used in purification of recombinant condensin I; Kinoshita et al., 2022 |
| Peptide, recombinant protein | Benzonase nuclease | Novagen | 71205 | Used in purification of recombinant condensin I; Kinoshita et al., 2022 |
| Peptide, recombinant protein | λ Protein Phosphatase | New England Biolabs | P0753S | |
| Peptide, recombinant protein | Nt.BspQI nicking endonuclease | New England Biolabs | R0644S | |
| Peptide, recombinant protein | EcoRI restriction enzyme | TaKaRa Bio | 1040A | |
| Peptide, recombinant protein | Serotropin (PMSG) | ASKA Pharmaceutical Co, Ltd | Used in preparation of HSS; Shintomi and Hirano, 2018 |
|
| Peptide, recombinant protein | Gonatropin (HCG) | ASKA Pharmaceutical Co, Ltd | Used in preparation of HSS; Shintomi and Hirano, 2018 |
|
| Recombinant DNA reagent | pUC19 | Genbank: L9137 | RRID: Addgene_50005 | |
| Recombinant DNA reagent | λDNA | New England Biolabs | N3011S | |
| Sequence-based reagent | hCAP-H (CH) deletion-F | This paper | Forward primer | GAACGACTTCTCTACCGACTCTCCC |
| Sequence-based reagent | hCAP-H (CH) deletion-R | This paper | Reverse primer | GTAGAGAAGTCGTTCTGAGGGAAGTC |
| Sequence-based reagent | hCAP-H (WT and dN) forward | This paper | Forward primer | GAAGCGCGCGGAATTCGCCA |
| Sequence-based reagent | hCAP-H (WT) reverse | This paper | Reverse primer | GAAGTACAGGTCCTCAGTGGTAGGTT CCAGGTCGCCCTGCCTAACTAA |
| Sequence-based reagent | hCAP-H (dN) reverse | This paper | Reverse primer | GAAGTACAGGTCCTCAGTGGTAGGTT CCAGGTCGCCCTGCCTGACTAA |
| Sequence-based reagent | HaloTag forward | This paper | Forward primer | GAGGACCTGTACTTCCAGTCTGACAAC GACATGGCCGAAATCGGAACT |
| Sequence-based reagent | HaloTag reverse | This paper | Reverse primer | AGCGGCCGCGACTAGTTTATC CGCTGATTTCCAGGGTA |
| Commercial assay or kit | PrimeSTAR Mutagenesis Basal Kit | TaKaRa Bio | R046A | |
| Commercial assay or kit | In-Fusion HD Cloning Kit | TaKaRa Bio | 639650 | |
| Commercial assay or kit | Nucleobond PC100 | MACHERREY-NAGEL GmbH & Co KG | 740573.100 | |
| Chemical compound, drug | Cytochalasin D | Sigma-Aldrich | C8273 | Used in preparation of HSS; Shintomi and Hirano, 2018 |
| Chemical compound, drug | ATP | Sigma-Aldrich | A2383 | |
| Chemical compound, drug | AMP-PNP | Jena Bioscience | NU-407 | |
| Software, algorithm | UNICORN7 | Cytiva | ||
| Software, algorithm | Prism 8 | GraphPad | ||
| Software, algorithm | Olympus cellSens Dimensions | Olympus | ||
| Software, algorithm | Excel | Microsoft | ||
| Software, algorithm | Photoshop | Adobe | ||
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij | ||
| Other | Immobilon Western Chemiluminescent HRP Substrate | Millipore | WBKLS500 | Used detection of immunoblots |
| Other | Alexa Fluor 488-conjugated streptavidin | Thermo Fisher Scientific | S11223 | IF (1/500) |
| Other | Streptavidin | Merck | S4762 | 1 mg/ml (Loop extrusion assay) |
| Other | HaloTag Alexa Fluor 488 Ligand | Promega | G1001 | |
| Other | PD-10 column | Cytiva | 17-0851-01 | |
| Other | Dynabeads Protein A | Thermo Fisher Scientific | 10002D | For immunodepletion with HSS and immunoprecipitation in topological loading assay |
| Other | rProtein A Sepharose Fast Flow | Cytiva | 17-1279-01 | For immunoprecipitation with HSS |
| Other | Glutathione Sepharose 4B | Cytiva | 17075601 | Used in purification of recombinant condensin I; Kinoshita et al., 2022 |
| Other | HiTrap Q HP 1 ml | Cytiva | 17115301 | Used in purification of recombinant condensin I; Kinoshita et al., 2022 |
| Other | Amicon Ultra-15 | Millipore | UFC905024 | Used in ultrafiltration of purified condensin I; Kinoshita et al., 2022 |
| Other | DAPI | Roche | 10236276001 | IF (2 μg/ml) |
| Other | GelRed | Biotium | 41003 | |
| Other | Sytox Orange | Thermo Fisher Scientific | S11368 |