Table 2.

Example oligonucleotide sequences for prime editing procedure

Step	Oligo Name	Sequence (5’ -3’)	Purpose	Usage
3A(i)	Golden Gate Part 1, top oligo	CACC(N20–21)GTTTT	Top oligo with cloning overhangs to insert the desired spacer (target) sequence	Replace the (N20–21) with the desired epegRNA or sgRNA spacer sequence.
3A(i)	Golden Gate Part 1, bottom oligo	CTCTAAAAC(N20–21)	Bottom oligo with cloning overhangs to insert the desired spacer (target) sequence	Replace the (N20–21) with the reverse complement of the desired epegRNA or sgRNA spacer sequence.
3A(i)	Golden Gate Part 2, top oligo	/5Phos/AGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG	Top oligo with cloning overhangs to insert a standard SpCas9 sgRNA scaffold sequence in an epegRNA cloning reaction	This oligo must be 5′ phosphorylated for the epegRNA Golden Gate assembly to work. The position of the 5′ phosphorylation is indicated with the bolded /5Phos/ notation. If cloning sgRNAs, alternate Golden Gate Part 2 oligos must be used (see below).
3A(i)	Golden Gate Part 2, bottom oligo	/5Phos/GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAG	Bottom oligo with cloning overhangs to insert a standard SpCas9 sgRNA scaffold sequence in an epegRNA cloning reaction	This oligo must be 5′ phosphorylated for the epegRNA Golden Gate assembly to work. The position of the 5′ phosphorylation is indicated with the bolded /5Phos/ notation. If cloning sgRNAs, alternate Golden Gate Part 2 oligos must be used (see below).
3A(i)	Golden Gate Part 2, top oligo [sgRNA alternate]	/5Phos/AGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	Top oligo with cloning overhangs to insert a standard SpCas9 sgRNA scaffold sequence in a sgRNA cloning reaction	This oligo must be 5′ phosphorylated for the sgRNA Golden Gate assembly to work. The position of the 5′ phosphorylation is indicated with the bolded /5Phos/ notation. If cloning epegRNAs, alternate Golden Gate Part 2 oligos must be used (see above).
3A(i)	Golden Gate Part 2, bottom oligo [sgRNA alternate]	/5Phos/AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAG	Bottom oligo with cloning overhangs to insert a standard SpCas9 sgRNA scaffold sequence in an sgRNA cloning reaction	This oligo must be 5′ phosphorylated for the sgRNA Golden Gate assembly to work. The position of the 5′ phosphorylation is indicated with the bolded /5Phos/ notation. If cloning epegRNAs, alternate Golden Gate Part 2 oligos must be used (see above).
3A(i)	Golden Gate Part 3, top oligo	GTGC(Nextenison)	Top oligo with cloning overhangs to insert the desired epegRNA RTT/PBS 3′ extension	Replace the (Nextenison) with the desired epegRNA RTT/PBS 3′ extension.
3A(i)	Golden Gate Part 3, bottom oligo	CGCG(Nextension)	Bottom oligo with cloning overhangs to insert the desired epegRNA RTT/PBS 3′ extension	Replace the (Nextenison) with the reverse complement of the desired epegRNA rTt/PBS 3′ extension.
3B(i)	Isothermal gene fragment	CTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(NepegRNA)TTTTTTTAAGCTTGGGCCGCTCGAGGTACCTCTCTACATATGACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTC	Gene fragment to insert a complete epegRNA or sgRNA with isothermal assembly overhangs. (Note: unlike the other sequences listed in this table, the isothermal gene fragment should be a double-stranded DNA piece, not a single-stranded oligonucleotide.)	Replace the (NepegRNA) with the sequence of the desired epegRNA or sgRNA. epegRNA sequences should include a spacer, sgRNA scaffold, RTT, PBS and 3′ structural motif. sgRNA sequences should include a spacer and sgRNA scaffold. The underlined sequence is an isothermal assembly cloning overhang that overlaps the human U6 promoter from the 3′ end of the PCR amplified product from Step 3B(iii). The italicized sequence is an isothermal assembly cloning overhang that overlaps to the 5′ end of the PCR amplified product from Step 3B(iii).
3B(ii)	Isothermal assembly forward primer	CAAAAATCGACGCTCAAGTC	Forward primer to PCR amplify pU6-tevopreq1-GG-acceptor plasmid for isothermal assembly	Anneals to the pU6-tevopreq1-GG-acceptor plasmid origin of replication to amplify the full-length plasmid for an isothermal assembly.
3B(ii)	Isothermal assembly reverse primer	ACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAG	Reverse primer to PCR amplify pU6-tevopreq1-GG-acceptor plasmid for isothermal assembly	Anneals to the pU6-tevopreq1-GG-acceptor plasmid human U6 promoter sequence to amplify the full-length plasmid for an isothermal assembly.
4	in vitro transcription forward primer	TCGAGCTCGGTACCTAATACGACTCACTATAAGG	Forward primer for PCR amplification of a template for in vitro transcription of editor mRNA	Amplification with this primer installs a functional T7 promoter sequence into the generated PCR amplicon.
4	in vitro transcription reverse primer	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTCCTACTCAGGCTTTATTCAAAGACCA	Reverse primer for PCR amplification of a template for in vitro transcription of editor mRNA	Amplification with this primer installs a templated poly(A) tail.
27	PCR1 Forward	ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN (NAnneal)	Forward primer for amplifying gDNA in preparation for HTS	Replace NAnneal with a sequence matching the 5′ end of the targeted genomic site (for a 300 bp amplicon, this primer should typically anneal to the genomic region ~150 nt 5′ of the target prime edit). The Illumina PCR1 forward adapter is shown in italics.
27	PCR1 Reverse	TGGAGTTCAGACGTGTGCTCTTCCGATCT(NAnneal)	Reverse primer for amplifying gDNA in preparation for HTS	Replace NAnneal with a sequence matching the reverse complement of the 3′ end of the targeted genomic site (for a 300 bp amplicon, this primer should typically anneal to the genomic region ~150 nt 3′ of the target prime edit). The Illumina PCR1 reverse adapter is shown in italics.