Figure 4.

Transcription of SOX4 gene is activated by SP1 in HCC cells. (A) SP1 is a potential transcription factor that binds to the promoter region of the SOX4 gene (5′‐AAGCCAATGGGAAGCCCGGG‐3′, Chr. 6: 21596634 to 21596653). (B) and (C) ChIP assay was carried out for investigating the direct interaction between SOX4 and Anillin gene promoter (**p < 0.01). IgG was used as the negative control. (D) Analysis of the TCGA liver cancer data set demonstrates a significant positive expression correlation between SP1 and SOX4 (p = 4.9e−23). (E) Depletion of SP1 in Hep3B cells was validated through immunofluorescence detection and induced a significant descent of SOX4 mRNA level (**p < 0.01). mRNA, messenger RNA; TCGA, the Cancer Genome Altas. [Color figure can be viewed at wileyonlinelibrary.com]