KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Cytochrome C | Invitrogen | Cat# MA5-11823; RRID: AB_10987059 |
| COX-IV | Abcam | Cat# ab33985; RRID: AB_879754 |
| PDHA1 (phospho S293) | Abcam | Cat# ab92696; RRID: AB_10711672 |
| KGA/GAC | Proteintech | Cat# 12855-1-AP; RRID: AB_2110381 |
| Phospho-Histone H2A.X (Ser139) | Cell Signaling | Cat# 9718; RRID: AB_2118009 |
| Tomm20 | Abcam | Cat# ab186735; RRID: AB_2889972 |
| Cytokeratin 14 | Invitrogen | Cat# PA5-32460; RRID: AB_2549929 |
| Laminin | Abcam | Cat# ab11575; RRID: AB_298179 |
| Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A11008; RRID: AB_143165 |
| Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat# A11012; RRID: AB_2534079 |
| Goat anti-mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A11001; RRID: AB_2534069 |
| Goat anti-mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat# A11005; RRID: AB_2534073 |
| SAPK/JNK | Cell Signaling | Cat# 9252; RRID: AB_2250373 |
| Phospho-SAPK/JNK (Thr183/Tyr185) | Cell Signaling | Cat# 9255; RRID: AB_2307321 |
| P38 MAPK | Cell Signaling | Cat# 8690; RRID: AB_10999090 |
| Phospho-p38 MAPK (Thr180/Tyr182) | Cell Signaling | Cat# 4511; RRID: AB_2139682 |
| P44/42 MAPK (Erk1/2) | Cell Signaling | Cat# 4695; RRID: AB_390779 |
| Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) | Cell Signaling | Cat# 4370; RRID: AB_2315112 |
| JNK1 | Santa Cruz Biotechnology | Cat# sc-1648; RRID: AB_675868 |
| JNK2 | Cell Signaling | Cat# 9258; RRID: AB_2141027 |
| NANOG | R&D Systems | Cat# AF1997; RRID: AB_355097 |
| GAPDH | Cell Signaling | Cat# 5174; RRID: AB_10622025 |
| Anti-rabbit IgG HRP linked | Cell Signaling | Cat# 7074; RRID: AB_2099233 |
| Anti-mouse IgG HRP linked | Cell Signaling | Cat# 7076; RRID: AB_330924 |
| Antibody dilutions and application, see Table S2 | ||
| Biological samples | ||
| Heart and skin tissues from aged mice (19–24 months) or young mice (4 months) of mixed genders (C57BL/6 strain) | National Institute on Aging | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Mitotracker Red | Invitrogen | Cat# M7512 |
| DCFDA/H2DCFDA-Cellular ROS Assay Kit | Abcam | Cat# ab113851 |
| 2-NBDG | Invitrogen | Cat# N13195 |
| SYBR green PCR mix | Applied Biosystems | Cat# 4309155 |
| Antimycin | Sigma | Cat# A8674 |
| Rotenone | Sigma | Cat# R8875 |
| Oligomycin | Sigma | Cat# O4876 |
| TMPD | Sigma | Cat# 87890 |
| Succinate | Sigma | Cat# S9512 |
| L-Ascorbic Acid | Fisher Scientific | Cat# A61100 |
| Sodium Azide | Sigma | Cat# S8032 |
| 2-DG | Sigma | Cat# D8375 |
| Glucose | Agilent technologies | Cat# 103577-100 |
| Pyruvate | Agilent technologies | Cat# 103578-100 |
| Glutamine | Agilent technologies | Cat# 103579-100 |
| Seahorse XF DMEM Medium | Agilent technologies | Cat# 103575-100 |
| Seahorse XFe96 FluxPak | Agilent technologies | Cat# 102416-100 |
| CB-839 (GLS inhibitor) | Selleckchem | Cat# S7655 |
| BPTES (GLS inhibitor) | Selleckchem | Cat# S7753 |
| Corn Oil | Selleckchem | Cat# S6701 |
| M.O.M Immunodetection kit | Vector Laboratories | Cat# BMK-2202 |
| Hoechst 33342 | Invitrogen | Cat# 62249 |
| Critical commercial assays | ||
| Luminescent ATP detection Assay Kit | Abcam | Cat# ab113849 |
| Lactate-Glo Assay | Promega | Cat# J5021 |
| Glutamate Assay Kit | Abcam | Cat# ab83389 |
| Alpha Ketoglutarate Assay Kit | Abcam | Cat# ab83431 |
| PicoProbe Glutaminase Assay Kit | Biovision | Cat# K455-100 |
| Pyruvate Assay Kit | Abcam | Cat# ab65342 |
| Ammonia Assay Kit | Abcam | Cat# ab83360 |
| Urea Assay Kit | Abcam | Cat# ab83362 |
| DCF ROS/RNS Assay Kit | Abcam | Cat# ab238535 |
| Senescence Detection Kit | Abcam | Cat# ab65351 |
| Experimental models: Cell lines | ||
| Human: Mesenchymal stem cells isolated from hair follicle | Bajpai et al.60 | N/A |
| Human: dermal fibroblasts from patients suffering from Hutchison-Gilford Progeria Syndrome with classic mutation | The Progeria Research Foundation | HGADFN167 |
| Human: dermal fibroblasts from father of HGPS patient without mutation | The Progeria Research Foundation | HGADFN168 |
| Experimental models: Organisms/strains | ||
| Mouse: LAKI (C57BL/6, LmnaG609G/+) | Provided by Dr. Dudley Lamming | N/A |
| Oligonucleotides | ||
| shRNA targeting human SLC14A1 GGGCTCTGAGTATATAACTGT | This paper | N/A |
| shRNA targeting human JNK1 GGGCCTACAGAGAGCTAGTTCTTAT | You et al.61 | N/A |
| shRNA targeting human JNK2 GCCAACTGTGAGGAATTATGTCGAA | You et al.61 | N/A |
| shRNA targeting human GLS1_1 GGAGCAATTGTTGTGACTTCA | This paper | N/A |
| shRNA targeting human GLS1_2 GCATTCCTGTGGCATGTATGA | This paper | N/A |
| Primers for qPCR, see Table S1 | N/A | N/A |
| Software and algorithms | ||
| Graphpad Prism 8 | Graphpad | https://www.graphpad.com/ |
| ImageJ | NIH | https://imagej.nih.gov/ij/ |
| Biorender | Biorender | https://biorender.com/ |
| Zen 3.0 (blue edition) | Carl Zeiss | https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html |
| Microsoft Publisher | Microsoft | N/A |
| Seahorse Wave Desktop | Agilent technologies | https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolic-analysis/xf-software/seahorse-wave-desktop-software-740897 |