KEY RESOURCES TABLE
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Cytochrome C | Invitrogen | Cat# MA5-11823; RRID: AB_10987059 |
COX-IV | Abcam | Cat# ab33985; RRID: AB_879754 |
PDHA1 (phospho S293) | Abcam | Cat# ab92696; RRID: AB_10711672 |
KGA/GAC | Proteintech | Cat# 12855-1-AP; RRID: AB_2110381 |
Phospho-Histone H2A.X (Ser139) | Cell Signaling | Cat# 9718; RRID: AB_2118009 |
Tomm20 | Abcam | Cat# ab186735; RRID: AB_2889972 |
Cytokeratin 14 | Invitrogen | Cat# PA5-32460; RRID: AB_2549929 |
Laminin | Abcam | Cat# ab11575; RRID: AB_298179 |
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A11008; RRID: AB_143165 |
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat# A11012; RRID: AB_2534079 |
Goat anti-mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A11001; RRID: AB_2534069 |
Goat anti-mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat# A11005; RRID: AB_2534073 |
SAPK/JNK | Cell Signaling | Cat# 9252; RRID: AB_2250373 |
Phospho-SAPK/JNK (Thr183/Tyr185) | Cell Signaling | Cat# 9255; RRID: AB_2307321 |
P38 MAPK | Cell Signaling | Cat# 8690; RRID: AB_10999090 |
Phospho-p38 MAPK (Thr180/Tyr182) | Cell Signaling | Cat# 4511; RRID: AB_2139682 |
P44/42 MAPK (Erk1/2) | Cell Signaling | Cat# 4695; RRID: AB_390779 |
Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) | Cell Signaling | Cat# 4370; RRID: AB_2315112 |
JNK1 | Santa Cruz Biotechnology | Cat# sc-1648; RRID: AB_675868 |
JNK2 | Cell Signaling | Cat# 9258; RRID: AB_2141027 |
NANOG | R&D Systems | Cat# AF1997; RRID: AB_355097 |
GAPDH | Cell Signaling | Cat# 5174; RRID: AB_10622025 |
Anti-rabbit IgG HRP linked | Cell Signaling | Cat# 7074; RRID: AB_2099233 |
Anti-mouse IgG HRP linked | Cell Signaling | Cat# 7076; RRID: AB_330924 |
Antibody dilutions and application, see Table S2 | ||
Biological samples | ||
Heart and skin tissues from aged mice (19–24 months) or young mice (4 months) of mixed genders (C57BL/6 strain) | National Institute on Aging | N/A |
Chemicals, peptides, and recombinant proteins | ||
Mitotracker Red | Invitrogen | Cat# M7512 |
DCFDA/H2DCFDA-Cellular ROS Assay Kit | Abcam | Cat# ab113851 |
2-NBDG | Invitrogen | Cat# N13195 |
SYBR green PCR mix | Applied Biosystems | Cat# 4309155 |
Antimycin | Sigma | Cat# A8674 |
Rotenone | Sigma | Cat# R8875 |
Oligomycin | Sigma | Cat# O4876 |
TMPD | Sigma | Cat# 87890 |
Succinate | Sigma | Cat# S9512 |
L-Ascorbic Acid | Fisher Scientific | Cat# A61100 |
Sodium Azide | Sigma | Cat# S8032 |
2-DG | Sigma | Cat# D8375 |
Glucose | Agilent technologies | Cat# 103577-100 |
Pyruvate | Agilent technologies | Cat# 103578-100 |
Glutamine | Agilent technologies | Cat# 103579-100 |
Seahorse XF DMEM Medium | Agilent technologies | Cat# 103575-100 |
Seahorse XFe96 FluxPak | Agilent technologies | Cat# 102416-100 |
CB-839 (GLS inhibitor) | Selleckchem | Cat# S7655 |
BPTES (GLS inhibitor) | Selleckchem | Cat# S7753 |
Corn Oil | Selleckchem | Cat# S6701 |
M.O.M Immunodetection kit | Vector Laboratories | Cat# BMK-2202 |
Hoechst 33342 | Invitrogen | Cat# 62249 |
Critical commercial assays | ||
Luminescent ATP detection Assay Kit | Abcam | Cat# ab113849 |
Lactate-Glo Assay | Promega | Cat# J5021 |
Glutamate Assay Kit | Abcam | Cat# ab83389 |
Alpha Ketoglutarate Assay Kit | Abcam | Cat# ab83431 |
PicoProbe Glutaminase Assay Kit | Biovision | Cat# K455-100 |
Pyruvate Assay Kit | Abcam | Cat# ab65342 |
Ammonia Assay Kit | Abcam | Cat# ab83360 |
Urea Assay Kit | Abcam | Cat# ab83362 |
DCF ROS/RNS Assay Kit | Abcam | Cat# ab238535 |
Senescence Detection Kit | Abcam | Cat# ab65351 |
Experimental models: Cell lines | ||
Human: Mesenchymal stem cells isolated from hair follicle | Bajpai et al.60 | N/A |
Human: dermal fibroblasts from patients suffering from Hutchison-Gilford Progeria Syndrome with classic mutation | The Progeria Research Foundation | HGADFN167 |
Human: dermal fibroblasts from father of HGPS patient without mutation | The Progeria Research Foundation | HGADFN168 |
Experimental models: Organisms/strains | ||
Mouse: LAKI (C57BL/6, LmnaG609G/+) | Provided by Dr. Dudley Lamming | N/A |
Oligonucleotides | ||
shRNA targeting human SLC14A1 GGGCTCTGAGTATATAACTGT | This paper | N/A |
shRNA targeting human JNK1 GGGCCTACAGAGAGCTAGTTCTTAT | You et al.61 | N/A |
shRNA targeting human JNK2 GCCAACTGTGAGGAATTATGTCGAA | You et al.61 | N/A |
shRNA targeting human GLS1_1 GGAGCAATTGTTGTGACTTCA | This paper | N/A |
shRNA targeting human GLS1_2 GCATTCCTGTGGCATGTATGA | This paper | N/A |
Primers for qPCR, see Table S1 | N/A | N/A |
Software and algorithms | ||
Graphpad Prism 8 | Graphpad | https://www.graphpad.com/ |
ImageJ | NIH | https://imagej.nih.gov/ij/ |
Biorender | Biorender | https://biorender.com/ |
Zen 3.0 (blue edition) | Carl Zeiss | https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html |
Microsoft Publisher | Microsoft | N/A |
Seahorse Wave Desktop | Agilent technologies | https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolic-analysis/xf-software/seahorse-wave-desktop-software-740897 |