Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Neurofilament heavy chain (chicken polyclonal) |
Aves Lab | NFH | 1:750 |
| Antibody | Anti-chicken Cy3 (donkey polyclonal) |
Jackson Immunoresearch | 703-165-155 | 1:200 |
| Antibody | Iba1 (rabbit polyclonal) |
Wako Chemicals | 019-19741 | 1:500 |
| Antibody | F4/80 (rat IgG2b monoclonal) |
Thermo Fisher Scientific | ma1-91124 | 1:500–1:1000 |
| Antibody | CD68 (rabbit polyclonal) |
Abcam | ab125212 | 1:500 |
| Antibody | SCG10 (rabbit polyclonal) |
Novus Biologicals | NBP149461 | 1:500–1:1000 |
| Antibody | CD11b (rabbit monoclonal) |
Abcam | ab133357 | 1:200–1:1000 |
| Antibody | ERK1/2 (rabbit polyclonal) |
Cell Signaling | 9102 | 1:5000 |
| Antibody | Anti-rabbit HRP (donkey polyclonal) |
EMD Millipore | AP182P | 1:2000–1:10,000 |
| Antibody | CD16/32 (rat IgG2a monoclonal) |
BD Pharmingen | 553141 | 1 µg/1 million cells/25 µl |
| Antibody | CD11b-PE-Cy7 (rat IgG2b monoclonal) |
Thermo Fisher Scientific | 25-0112-82 | 1:200 |
| Antibody | Isotype Control-PE-Cy7 (rat-IgG2b monoclonal) |
Thermo Fisher Scientific | 25-4031-82 | 1:100 |
| Antibody | CD45-e450 (rat-IgG2b monoclonal) |
Thermo Fisher Scientific | 48-0451-82 | 1:100 |
| Antibody | CD45.1-e450 (mouse-IgG2a monoclonal) |
BioLegend | 110721 | 1:100 |
| Antibody | Isotype Control-e450 (mouse-IgG2a monoclonal) |
BioLegend | 400235 | 1:100 |
| Antibody | CD45.2-APC (mouse-IgG2a monoclonal) |
BioLegend | 109813 | 1:100 |
| Antibody | Isotype Control-APC (mouse-IgG2a monoclonal) |
BioLegend | 400221 | 1:100 |
| Antibody | Ly6G-APC-Cy7 (rat-IgG2a monoclonal) |
BD Biosciences | 560600 | 1:100 |
| Antibody | CD11c-PerCP-Cy5.5 (ArmHam-IgG monoclonal) |
Thermo Fisher Scientific | 45-0114-82 | 1:100 |
| Antibody | Isotype Control-PerCP-Cy5.5 (ArmHam-IgG monoclonal) |
Thermo Fisher Scientific | 45-4888-80 | 1:100 |
| Antibody | Ly6C-FITC (rat-IgM monoclonal) |
BD Biosciences | 553104 | 1:100 |
| Antibody | Isotype Control-FITC (rat-IgM monoclonal) |
BD Biosciences | 553942 | 1:100 |
| Antibody | Iba1 (goat polyclonal) | Novus Biologicals | NB100-1028 | 1:200 |
| Antibody | Anti-goat Alexa Fluor 488 (donkey polyclonal) |
Jackson Immunoresearch | 705-545-147 | 1:200 |
| Antibody | LDHA (rabbit polyclonal) |
Cell Signaling Technology | 2558 | 1:300 |
| Chemical compound, drug | TOPRO pan-nuclear stain | Thermo Fisher Scientific | T3605 | 1:2000 |
| Chemical compound, drug | Fixable Viability Dye | Thermo Fisher Scientific | 65086614 | 1:500 |
| Chemical compound, drug | Proteinase K | New England Biolabs | P8107S | |
| Chemical compound, drug | 10 mM dNTP mix | Promega | C1141 | |
| Chemical compound, drug | 5X Green GoTaq Buffer | Promega | M791A | |
| Chemical compound, drug | GoTaq DNA polymerase | Promega | M3005 | |
| Chemical compound, drug | Buprenorphine | Par Pharmaceutical | NDC12496-0757-1 | |
| Chemical compound, drug | Ketamine | Par Pharmaceutical | NDC42023-115-10 | |
| Chemical compound, drug | Xylazine | Akorn | NDC59399-110-20 | |
| Chemical compound, drug | Fluriso (Isoflurane, USP) | Vet One | 501017 | |
| Chemical compound, drug | Rhodamine-conjugated dextran MW 3000 (Microruby) |
Life Technologies | D-7162 | |
| Chemical compound, drug | Cholera toxin B (CTB) | Life Technologies | C34775 | |
| Chemical compound, drug | Puralube Eye ointment | Dechra | NDC-17033-211-38 | |
| Chemical compound, drug | N2 media supplement | Gibco | 17502048 | Cell culture |
| Chemical compound, drug | N1 media supplement | Sigma | N6530 | Cell culture |
| Chemical compound, drug | Leibovitz-15 (L-15) | Gibco | 21083-027 | Cell culture |
| Chemical compound, drug | Penicillin/Streptomycin | Life Technologies | 15140-122 | Cell culture |
| Chemical compound, drug | DMEM Ham’s F-12 | Gibco | 10565-018 | Cell culture |
| Chemical compound, drug | Fetal bovine serum | Atlanta Biologicals | S11550 | Cell culture |
| Chemical compound, drug | Cytosine arabinoside | Sigma-Aldrich | C1768 | Cell culture |
| Chemical compound, drug | Collagenase type 2 | Worthington Biochemical | LS004176 | Tissue digestion |
| Chemical compound, drug | PBS without calcium, magnesium |
Gibco | 10010023 | Cell culture |
| Chemical compound, drug | Poly-L-lysine MW 70,000–150,000 |
Sigma-Aldrich | P4707 | Cell culture |
| Chemical compound, drug | Laminin | Sigma-Aldrich | L2020 | Cell culture |
| Chemical compound, drug | Paraformaldehyde | Sigma-Aldrich | 158127-500G | |
| Chemical compound, drug | Triton-X100 | Sigma-Aldrich | T8787 | |
| Chemical compound, drug | Bovine serum albumin (BSA) heat shock fraction V |
Fisher Scientific | BP1600 | |
| Chemical compound, drug | Hoechst 33342 | Invitrogen | H3570 | Nuclear dye |
| Chemical compound, drug | Tissue-Tek O.C.T. Compound | Electron Microscopy Sciences | 62550-01 | |
| Chemical compound, drug | β-Glycerophosphate | Sigma-Aldrich | G9422-100G | |
| Chemical compound, drug | Sodium orthovanadate (Na3VO4) |
Sigma-Aldrich | S6508-10G | |
| Chemical compound, drug | Protease inhibitor cocktail | Sigma-Aldrich | P8340-5ML | |
| Chemical compound, drug | DC Protein Assay Kit | Bio-Rad | 5000111 | |
| Chemical compound, drug | 2× Laemmli sample buffer | Bio-Rad | 1610737 | |
| Chemical compound, drug | β-Mercaptoethanol | EMD Millipore | 6010 | |
| Chemical compound, drug | Blotting-grade blocker | Bio-Rad | 1706404 | |
| Chemical compound, drug | SuperSignal West Pico PLUS Chemiluminescent Substrate | Thermo Fisher Scientific | 34580 | |
| Chemical compound, drug | SuperSignal West Femto Maximum Sensitivity Substrate |
Thermo Fisher Scientific | 34095 | |
| Chemical compound, drug | WesternSure PREMIUM Chemi Substrate |
LI-COR Biosciences | 926-95000 | |
| Chemical compound, drug | Fixable Viability Dye eF506 | Thermo Fisher Scientific | 65-0866-14 | |
| Chemical compound, drug | TRIzol | Thermo Fisher Scientific | 15596026 | |
| Chemical compound, drug | Dispase | Sigma-Aldrich | D4693 | |
| Chemical compound, drug | Actinomycin D | Sigma-Aldrich | A1410 | |
| Chemical compound, drug | Percoll | Sigma-Aldrich | P4937 | |
| Chemical compound, drug | MACS buffer | Miltenyi | 130-091-376 | |
| Chemical compound, drug | CD45 MicroBeads | Miltenyi | 130-052-301 | |
| Chemical compound, drug | CD11b MicroBeads | Miltenyi | 130-049-601 | |
| Chemical compound, drug | Myelin removal Beads | Miltenyi | 130-096-733 | |
| Chemical compound, drug | LS Columns | Miltenyi | 130-042-401 | |
| Chemical compound, drug | Hanks balanced salt solution | Gibco | 14025092 | |
| Chemical compound, drug | Sucrose | Fisher Scientific | S5-500 | |
| Other | Superfrost Plus Microscope Slides | Fisher Scientific | 12-550-15 | For histology |
| Other | Zeiss Axio Observer Z1 | Zeiss | 491912-0049-000 | Microscope |
| Other | Zeiss Axiocam 503 mono camera | Zeiss | 426559-0000-000 | Microscope camera |
| Other | EC PlnN ×10 objective | Zeiss | 420341-9911-000 | Objective for microscope |
| Other | Motorized tissue homogenizer | RPI | 299200 | Homogenization of nerve tissue |
| Other | Fisher Scientific Sonic Dismembrator | Fisher Scientific | Model 500 | Western blot equipment |
| Other | photo spectrometer | Molecular Devices | SpectraMax M5e | Measurement of protein concentration |
| Other | LI-COR C-Digit | LI-COR Biosciences | CDG-001313 | Scanning of Western blot membranes |
| Other | 40 µm filter | BD Falcon | 352340 | Cell isolation |
| Other | 70 µm cell strainer | Corning | 352350 | Cell isolation |
| Chemical compound, drug | PVDF membrane | EMD Millipore | IPVH00010 | |
| Chemical compound, drug | Ammonium-chloride-potassium (ACK) Lysing Buffer | Gibco | A1049201 | Removal of erythrocytes |
| Commercial assay or kit | Myelin Removal Beads | Miltenyi | 130-096-731 | |
| Commercial assay or kit | MidiMACS separator | Miltenyi | 130-042-302 | |
| Other | LS Columns | Miltenyi | 130-042-401 | Cell sorting |
| Other | Hemacytometer | MilliporeSigma | Z359629 | Cell counting |
| Commercial assay or kit | Chromium Next GEM Chip G | 10X Genomics, Inc | NC1000127 | |
| Other | 10X Genomic Chromium Controller | 10X Genomics, Inc | GCG-SR-1 | Barcoding of cells for scRNA-sequencing |
| Commercial assay or kit | Chromium Next GEM Single Cell 3′ Kit v3.1 |
10X Genomics, Inc | 1000268 | |
| Commercial assay or kit | Chromium Next GEM Chip G Single Cell Kit |
10X Genomics, Inc | 1000127 | |
| Commercial assay or kit | Dual Index Kit TT Set A | 10X Genomics, Inc | 1000125 | |
| Chemical compound, drug | Dynabeads | 10X Genomics, Inc | 2000048 | |
| Chemical compound, drug | SPRIselect | Beckman Coulter | B23318 | |
| Other | NovaSeq Illumina 6000 | Illumina | N/A | DNA library sequencing |
| Other | Cryostat | Leica Biosystems | CM3050S | Tissue sectioning |
| Other | Confocal Microscope | Nikon | C1 | Imaging of tissue sections |
| Other | Confocal Microscope | Leica Biosystems | SP8 | Imaging of tissue sections |
| Commercial assay or kit | Proteome Profiler, Mouse XL Cytokine membranes (ELISA) |
R&D Systems, Minneapolis, MN, USA | ARY028 | |
| Strain, strain background (Mus musculus) |
Sarm1-/- C57BL/6 |
Jackson Laboratories | Stock# 018069 | PMID:22678360 |
| Strain, strain background (M. musculus) |
ROSA26-mTdt/mGFP C57BL/6 |
Jackson Laboratories | Stock# 007576 | PMID:17868096; MGI: J:124702 |
| Strain, strain background (M. musculus) |
Arg1-eYFP C57BL/6 |
Jackson Laboratories | Stock# 015857 | PMID:17450126; MGI: J:122735; PMID:33263277 |
| Strain, strain background (M. musculus) |
CD45.1 C57BL/6 |
Jackson Laboratories | Stock# 002014 | PMID:11698303; MGI: J:109863; PMID:11994430; MGI: J:109854; PMID:12004082; MGI: J:109853 |
| Strain, strain background (M. musculus) | Wildtype, WT C57BL/6 |
Taconics | B6NTac | |
| Sequence-based reagent | Neomycin Forward | Integrated DNA Technologies | N/A | 5’-CTTGGGTGGAGAGGCTATTC-3’ |
| Sequence-based reagent | Neomycin Reverse | Integrated DNA Technologies | N/A | 5’-AGGTGAGATGACAGGAGATC-3’ |
| Software, algorithm | WIS-Neuromath | Weizmann Institute of Science | Version 3.4.8 | PMID:23055261 |
| Software, algorithm | Image Studio Software | LI-COR Biosciences | Version 5.2.5 | |
| Software, algorithm | NovaSeq control software | Illumina | Version 1.6 | |
| Software, algorithm | Real Time Analysis (RTA) software | Illumina | Version 3.4.4 | |
| Software, algorithm | CellRanger | 10X Genomics, Inc | Version 3.1.0 | |
| Software, algorithm | Seurat | Satija Lab–New York Genome Center | Version 4.0.5 | |
| Software, algorithm | Seurat | https://github.com/satijalab/seurat; Srivastava and Hoffman, 2022; Hao et al., 2021 | Version 4.1.1.9006 | |
| Software, algorithm | R | r-project.org | Version 4.1.2 | |
| Software, algorithm | SlingShot | bioconductor.org | Version 2.2.1 | |
| Software, algorithm | Ranger | Comprehensive R Archive Network | Version 0.13.1 | |
| Software, algorithm | CellChat | https://github.com/sqjin/CellChat; Jin and CaoWei-UM, 2022; Jin et al., 2021 | Version 1.1.3 | |
| Software, algorithm | shiny | Rstudio.com | Version 1.7.1 | |
| Software, algorithm | Prism | GraphPad | Versions 7 and 8 | |
| Software, algorithm | Ingenuity pathway analysis | QIAGEN | Version 81348237 |
|
| Software, algorithm | Imaris | Bitplane | ||
| Software, algorithm | Leica Application Suite (LAS X) | Leica | ||
| Software, algorithm | Zen Application Software | Zeiss | Pro 3.8 | |
| Other | SomnoSuite | Kent Scientific | SS-01 | Anesthesia |
| Other | Povidone-Iodine Prep Pad | PDI Healthcare | B40600 | Disinfection |
| Other | Alcohol Prep, Sterile, Md, 2 Ply | Covidien | 6818 | Disinfection |
| Other | Fine Forceps Dumont #55 Dumoxel | Roboz Surgical Instrument | RS-5063 | Surgical tool |
| Other | 7 mm Reflex Wound Clips | Cell Point Scientific | 203-1000 | Surgical tool |
| Other | Micro Friedman Rongeur | Roboz Surgical Instrument | RS-8306 | Surgical tool |
| Other | McPherson-Vannas Micro Dissecting Spring scissors | Roboz Surgical Instrument | RS-5600 | Surgical tool |
| Other | COATED VICRYL (polyglactin 910) Suture | Ethicon | J463G | Surgical suture |
| Other | Dumont #7 curved forceps | Fine Science Tools | 11271-30 | Surgical tool |
| Other | Miltex Halsted mosquito forceps | Integra LifeSciences | 724 | Surgical tool |
| Other | Nanofil 10 µl syringe | World Precision Instruments | NANOFIL | Small syringe |
| Other | 36g beveled nanofil needle | World Precision Instruments | NF36BV-2 | Perfusion |
| Other | Non-absorbable sutures | Ethicon | 640G | Surgical sutures for parabiosis |
| Other | Absorbable sutures | Ethicon | J463G | Surgical sutures |
| Sequence-based reagent | RNAscope Probe- Mm-Gpnmb-C3- Mus musculus glycoprotein (transmembrane) Gpnmb (Gpnmb) mRNA |
ACD Bio | 489511-C3 | 1:50 |
| Sequence-based reagent | RNAscope Probe- Mm-Ccl8-C2-Mus musculus chemokine (C-C motif) ligand 8 (Ccl8) mRNA |
ACD Bio | 546211-C2 | 1:50 |
| Sequence-based reagent | RNAscope Probe- Mm-Cd209a-C2- musculus CD209a antigen (Cd209a) mRNA | ACD Bio | 480311-C2 | 1:50 |
| Commercial assay or kit | RNAscope Multiplex Fluorescent Reagent Kit v2 |
ACD Bio | 323100 | |
| Other | Model 1525 incubator | VWR Scientific | 1525 | RNAscope equipment |
| Other | ACD hybridization oven | ACD Bio | 321710 | RNAscope equipment |
| Chemical compound, drug | Hydrogen peroxide solution | ACD Bio | PN 322381 | |
| Chemical compound, drug | 10× antigen retrieval solution | ACD Bo | 322000 | |
| Chemical compound, drug | Protease Plus solution | ACD Bio | 322331 | |
| Chemical compound, drug | Cy3 | AKOYA Biosciences | NEL744001KT | 1:2000 |
| Chemical compound, drug | Cy5 | AKOYA Biosciences | NEL745001KT | 1:2000 |
| Chemical compound, drug | DAPI mounting media | Southern Biotech | 0100-20 | |
| Chemical compound, drug | RNAscope wash buffer | ACD Bio | 310091 | |
| Chemical compound, drug | Formalin (1:10) | Fisherbrand | 427-098 | |
| Antibody | PFKfb3 (rabbit monoclonal) |
Cell Signaling Technology | 13123 | 1:300 |
| Antibody | PKM (rabbit polyclonal) |
Abcam | ab137791 | 1:300 |
| Antibody | Sox10 (goat polyclonal) |
R&D Systems | AF2864 | 1:300 |
| Sequence-based reagent | Spp1 Forward | This paper | PCR primer | AAGTCTAGGAGTTTCCAGGTTTC |
| Sequence-based reagent | Spp1 Reverse | This paper | PCR primer | GCTCTTCATGTGAGAGGTGAG |
| Sequence-based reagent | Gapdh Forward | This paper | PCR primer | AACTTTGGCATTGTGGAAGG |
| Sequence-based reagent | Gapdh Reverse | This paper | PCR primer | GGATGCAGGGATGATGTTCT |
| Sequence-based reagent | Chil3 Forward | This paper | PCR primer | AGCCCTCCTAAGGACAAAC |
| Sequence-based reagent | Chil3 Reverse | This paper | PCR primer | GGAATGTCTTTCTCCACAGATTC |
| Sequence-based reagent | Rlp13a Forward | This paper | PCR primer | GCTGCTCTCAAGGTTGTTC |
| Sequence-based reagent | Rlp13a Reverse | This paper | PCR primer | GTACTTCCACCCGACCTC |
| Sequence-based reagent | Hif1a Forward | This paper | PCR primer | CTGATGGAAGCACTAGACAAAG |
| Sequence-based reagent | Hif1a Reverse | This paper | PCR primer | CAATATTCACTGGGACTGTTAGG |
| Sequence-based reagent | Acod1 Forward | This paper | PCR primer | GGCACAGAAGTGTTCCATAAAG |
| Sequence-based reagent | Acod1 Reverse | This paper | PCR primer | GTGGGAGCCTGAAGTCTG |
| Sequence-based reagent | Il1b Forward | This paper | PCR primer | CTTCCAGGATGAGGACATGAG |
| Sequence-based reagent | Il1b Reverse | This paper | PCR primer | TCACACACCAGCAGGTTATC |
| Sequence-based reagent | Slc16a3 Forward | This paper | PCR primer | GCAGAAGCATTATCCAGATCTAC |
| Sequence-based reagent | Slc16a3 Reverse | This paper | PCR primer | GATTGAGCATGATGAGGGAAG |
| Sequence-based reagent | Ldha Forward | This paper | PCR primer | CATTGTCAAGTACAGTCCACAC |
| Sequence-based reagent | Ldha Reverse | This paper | PCR primer | TTCCAAGCCACGTAGGTC |
| Sequence-based reagent | Pkm Forward | This paper | PCR primer | CTGGATACAAAGGGACCTGAG |
| Sequence-based reagent | Pkm Reverse | This paper | PCR primer | CAGAGTGGCTCCCTTCTTC |
| Sequence-based reagent | Pgk1 Forward | This paper | PCR primer | GTGGAATGGCCTTTACCTTC |
| Sequence-based reagent | Pgk1 Reverse | This paper | PCR primer | GACAATCTTGGCTCCTTCTTC |
| Sequence-based reagent | Cd38 Forward | This paper | PCR primer | ACTGTCCCAACAACCCTATTAC |
| Sequence-based reagent | Cd38 Reverse | This paper | PCR primer | ATCACTTGGACCACACCAC |
| Sequence-based reagent | Pfkl Forward | This paper | PCR primer | CTGCTGAGCTACACAGAGG |
| Sequence-based reagent | Pfkl Reverse | This paper | PCR primer | CGTGTCCCTTGGTGAGAAG |
| Sequence-based reagent | Gatm Forward | This paper | PCR primer | TTGCTTTGATGCTGCTGAC |
| Sequence-based reagent | Gatm Reverse | This paper | PCR primer | CACTCGATGCCCAGGTAG |
| Chemical compound, drug | SYBR Green Fluorescein Master Mix | Thermo Scientific | 4364344 | |
| Other | QuantStudio 3 real-time PCR system | Applied Biosystems | A28567 | Genotyping |
| Other | Pestle motor mixer | RPI | 299200 | Tissue homogenization |
| Other | Nanodrop | Thermo Scientific | Measurement of nucleic acid concentration |
|
| Commercial assay or kit | SuperScript III First-Strand Synthesis System kit |
Invitrogen | 18080051 | |
| Chemical compound, drug | RIPA buffer | Sigma | R0278 | Supplemented with 50 mM BGP, 1 mM Na3VO4, and 1:100 PIC |
| Chemical compound, drug | DC protein assay | Bio-Rad | 5000111 | |
| Chemical compound, drug | β-Mercaptoethanol | Sigma | 60242 | |
| Chemical compound, drug | 2X Laemmli buffer | Bio-Rad | 1610737 | |
| Other | Immune-Blot PVDF membrane | BioRad | 1620260 | Western blotting |
| Chemical compound, drug | TBST blocking buffer | This paper | Buffer | 48.4 g Tris Base, 351.2 g NaCl, ddH2O 2 L, pH 7.4, 0.5% Tween- 20 with BSA 200 mg |
| Chemical compound, drug | Bovine serum albumin | Fisher | BP1600-100 | |
| Chemical compound, drug | SuperSignal West Pico PLUS Chemiluminescent Substrate | Thermo Fisher Scientific | 34580 |