Skip to main content
. 2022 Dec 14;11:e80881. doi: 10.7554/eLife.80881

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Antibody Neurofilament heavy chain
(chicken polyclonal)
Aves Lab NFH 1:750
Antibody Anti-chicken Cy3
(donkey polyclonal)
Jackson Immunoresearch 703-165-155 1:200
Antibody Iba1
(rabbit polyclonal)
Wako Chemicals 019-19741 1:500
Antibody F4/80
(rat IgG2b monoclonal)
Thermo Fisher Scientific ma1-91124 1:500–1:1000
Antibody CD68
(rabbit polyclonal)
Abcam ab125212 1:500
Antibody SCG10
(rabbit polyclonal)
Novus Biologicals NBP149461 1:500–1:1000
Antibody CD11b
(rabbit monoclonal)
Abcam ab133357 1:200–1:1000
Antibody ERK1/2
(rabbit polyclonal)
Cell Signaling 9102 1:5000
Antibody Anti-rabbit HRP
(donkey polyclonal)
EMD Millipore AP182P 1:2000–1:10,000
Antibody CD16/32
(rat IgG2a monoclonal)
BD Pharmingen 553141 1 µg/1 million cells/25 µl
Antibody CD11b-PE-Cy7
(rat IgG2b monoclonal)
Thermo Fisher Scientific 25-0112-82 1:200
Antibody Isotype Control-PE-Cy7
(rat-IgG2b monoclonal)
Thermo Fisher Scientific 25-4031-82 1:100
Antibody CD45-e450
(rat-IgG2b monoclonal)
Thermo Fisher Scientific 48-0451-82 1:100
Antibody CD45.1-e450
(mouse-IgG2a monoclonal)
BioLegend 110721 1:100
Antibody Isotype Control-e450
(mouse-IgG2a monoclonal)
BioLegend 400235 1:100
Antibody CD45.2-APC
(mouse-IgG2a monoclonal)
BioLegend 109813 1:100
Antibody Isotype Control-APC
(mouse-IgG2a monoclonal)
BioLegend 400221 1:100
Antibody Ly6G-APC-Cy7
(rat-IgG2a monoclonal)
BD Biosciences 560600 1:100
Antibody CD11c-PerCP-Cy5.5
(ArmHam-IgG monoclonal)
Thermo Fisher Scientific 45-0114-82 1:100
Antibody Isotype Control-PerCP-Cy5.5
(ArmHam-IgG monoclonal)
Thermo Fisher Scientific 45-4888-80 1:100
Antibody Ly6C-FITC
(rat-IgM monoclonal)
BD Biosciences 553104 1:100
Antibody Isotype Control-FITC
(rat-IgM monoclonal)
BD Biosciences 553942 1:100
Antibody Iba1 (goat polyclonal) Novus Biologicals NB100-1028 1:200
Antibody Anti-goat Alexa Fluor
488 (donkey polyclonal)
Jackson Immunoresearch 705-545-147 1:200
Antibody LDHA
(rabbit polyclonal)
Cell Signaling Technology 2558 1:300
Chemical compound, drug TOPRO pan-nuclear stain Thermo Fisher Scientific T3605 1:2000
Chemical compound, drug Fixable Viability Dye Thermo Fisher Scientific 65086614 1:500
Chemical compound, drug Proteinase K New England Biolabs P8107S
Chemical compound, drug 10 mM dNTP mix Promega C1141
Chemical compound, drug 5X Green GoTaq Buffer Promega M791A
Chemical compound, drug GoTaq DNA polymerase Promega M3005
Chemical compound, drug Buprenorphine Par Pharmaceutical NDC12496-0757-1
Chemical compound, drug Ketamine Par Pharmaceutical NDC42023-115-10
Chemical compound, drug Xylazine Akorn NDC59399-110-20
Chemical compound, drug Fluriso (Isoflurane, USP) Vet One 501017
Chemical compound, drug Rhodamine-conjugated
dextran MW 3000 (Microruby)
Life Technologies D-7162
Chemical compound, drug Cholera toxin B (CTB) Life Technologies C34775
Chemical compound, drug Puralube Eye ointment Dechra NDC-17033-211-38
Chemical compound, drug N2 media supplement Gibco 17502048 Cell culture
Chemical compound, drug N1 media supplement Sigma N6530 Cell culture
Chemical compound, drug Leibovitz-15 (L-15) Gibco 21083-027 Cell culture
Chemical compound, drug Penicillin/Streptomycin Life Technologies 15140-122 Cell culture
Chemical compound, drug DMEM Ham’s F-12 Gibco 10565-018 Cell culture
Chemical compound, drug Fetal bovine serum Atlanta Biologicals S11550 Cell culture
Chemical compound, drug Cytosine arabinoside Sigma-Aldrich C1768 Cell culture
Chemical compound, drug Collagenase type 2 Worthington Biochemical LS004176 Tissue digestion
Chemical compound, drug PBS without
calcium, magnesium
Gibco 10010023 Cell culture
Chemical compound, drug Poly-L-lysine MW
70,000–150,000
Sigma-Aldrich P4707 Cell culture
Chemical compound, drug Laminin Sigma-Aldrich L2020 Cell culture
Chemical compound, drug Paraformaldehyde Sigma-Aldrich 158127-500G
Chemical compound, drug Triton-X100 Sigma-Aldrich T8787
Chemical compound, drug Bovine serum albumin
(BSA) heat shock fraction V
Fisher Scientific BP1600
Chemical compound, drug Hoechst 33342 Invitrogen H3570 Nuclear dye
Chemical compound, drug Tissue-Tek O.C.T. Compound Electron Microscopy Sciences 62550-01
Chemical compound, drug β-Glycerophosphate Sigma-Aldrich G9422-100G
Chemical compound, drug Sodium orthovanadate
(Na3VO4)
Sigma-Aldrich S6508-10G
Chemical compound, drug Protease inhibitor cocktail Sigma-Aldrich P8340-5ML
Chemical compound, drug DC Protein Assay Kit Bio-Rad 5000111
Chemical compound, drug 2× Laemmli sample buffer Bio-Rad 1610737
Chemical compound, drug β-Mercaptoethanol EMD Millipore 6010
Chemical compound, drug Blotting-grade blocker Bio-Rad 1706404
Chemical compound, drug SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher Scientific 34580
Chemical compound, drug SuperSignal West Femto
Maximum Sensitivity Substrate
Thermo Fisher Scientific 34095
Chemical compound, drug WesternSure PREMIUM
Chemi Substrate
LI-COR Biosciences 926-95000
Chemical compound, drug Fixable Viability Dye eF506 Thermo Fisher Scientific 65-0866-14
Chemical compound, drug TRIzol Thermo Fisher Scientific 15596026
Chemical compound, drug Dispase Sigma-Aldrich D4693
Chemical compound, drug Actinomycin D Sigma-Aldrich A1410
Chemical compound, drug Percoll Sigma-Aldrich P4937
Chemical compound, drug MACS buffer Miltenyi 130-091-376
Chemical compound, drug CD45 MicroBeads Miltenyi 130-052-301
Chemical compound, drug CD11b MicroBeads Miltenyi 130-049-601
Chemical compound, drug Myelin removal Beads Miltenyi 130-096-733
Chemical compound, drug LS Columns Miltenyi 130-042-401
Chemical compound, drug Hanks balanced salt solution Gibco 14025092
Chemical compound, drug Sucrose Fisher Scientific S5-500
Other Superfrost Plus Microscope Slides Fisher Scientific 12-550-15 For histology
Other Zeiss Axio Observer Z1 Zeiss 491912-0049-000 Microscope
Other Zeiss Axiocam 503 mono camera Zeiss 426559-0000-000 Microscope camera
Other EC PlnN ×10 objective Zeiss 420341-9911-000 Objective for microscope
Other Motorized tissue homogenizer RPI 299200 Homogenization of nerve tissue
Other Fisher Scientific Sonic Dismembrator Fisher Scientific Model 500 Western blot equipment
Other photo spectrometer Molecular Devices SpectraMax M5e Measurement of protein concentration
Other LI-COR C-Digit LI-COR Biosciences CDG-001313 Scanning of Western blot membranes
Other 40 µm filter BD Falcon 352340 Cell isolation
Other 70 µm cell strainer Corning 352350 Cell isolation
Chemical compound, drug PVDF membrane EMD Millipore IPVH00010
Chemical compound, drug Ammonium-chloride-potassium (ACK) Lysing Buffer Gibco A1049201 Removal of erythrocytes
Commercial assay or kit Myelin Removal Beads Miltenyi 130-096-731
Commercial assay or kit MidiMACS separator Miltenyi 130-042-302
Other LS Columns Miltenyi 130-042-401 Cell sorting
Other Hemacytometer MilliporeSigma Z359629 Cell counting
Commercial assay or kit Chromium Next GEM Chip G 10X Genomics, Inc NC1000127
Other 10X Genomic Chromium Controller 10X Genomics, Inc GCG-SR-1 Barcoding of cells for scRNA-sequencing
Commercial assay or kit Chromium Next GEM Single
Cell 3′ Kit v3.1
10X Genomics, Inc 1000268
Commercial assay or kit Chromium Next GEM Chip
G Single Cell Kit
10X Genomics, Inc 1000127
Commercial assay or kit Dual Index Kit TT Set A 10X Genomics, Inc 1000125
Chemical compound, drug Dynabeads 10X Genomics, Inc 2000048
Chemical compound, drug SPRIselect Beckman Coulter B23318
Other NovaSeq Illumina 6000 Illumina N/A DNA library sequencing
Other Cryostat Leica Biosystems CM3050S Tissue sectioning
Other Confocal Microscope Nikon C1 Imaging of tissue sections
Other Confocal Microscope Leica Biosystems SP8 Imaging of tissue sections
Commercial assay or kit Proteome Profiler, Mouse XL
Cytokine membranes (ELISA)
R&D Systems, Minneapolis, MN, USA ARY028
Strain, strain background (Mus musculus) Sarm1-/-
C57BL/6
Jackson Laboratories Stock# 018069 PMID:22678360
Strain, strain background (M. musculus) ROSA26-mTdt/mGFP
C57BL/6
Jackson Laboratories Stock# 007576 PMID:17868096; MGI: J:124702
Strain, strain background (M. musculus) Arg1-eYFP
C57BL/6
Jackson Laboratories Stock# 015857 PMID:17450126; MGI: J:122735;
PMID:33263277
Strain, strain background (M. musculus) CD45.1
C57BL/6
Jackson Laboratories Stock# 002014 PMID:11698303; MGI: J:109863;
PMID:11994430; MGI: J:109854;
PMID:12004082; MGI: J:109853
Strain, strain background (M. musculus) Wildtype, WT
C57BL/6
Taconics B6NTac
Sequence-based reagent Neomycin Forward Integrated DNA Technologies N/A 5’-CTTGGGTGGAGAGGCTATTC-3’
Sequence-based reagent Neomycin Reverse Integrated DNA Technologies N/A 5’-AGGTGAGATGACAGGAGATC-3’
Software, algorithm WIS-Neuromath Weizmann Institute of Science Version 3.4.8 PMID:23055261
Software, algorithm Image Studio Software LI-COR Biosciences Version 5.2.5
Software, algorithm NovaSeq control software Illumina Version 1.6
Software, algorithm Real Time Analysis (RTA) software Illumina Version 3.4.4
Software, algorithm CellRanger 10X Genomics, Inc Version 3.1.0
Software, algorithm Seurat Satija Lab–New York Genome Center Version 4.0.5
Software, algorithm Seurat https://github.com/satijalab/seurat; Srivastava and Hoffman, 2022; Hao et al., 2021 Version 4.1.1.9006
Software, algorithm R r-project.org Version 4.1.2
Software, algorithm SlingShot bioconductor.org Version 2.2.1
Software, algorithm Ranger Comprehensive R Archive Network Version 0.13.1
Software, algorithm CellChat https://github.com/sqjin/CellChat; Jin and CaoWei-UM, 2022; Jin et al., 2021 Version 1.1.3
Software, algorithm shiny Rstudio.com Version 1.7.1
Software, algorithm Prism GraphPad Versions 7 and 8
Software, algorithm Ingenuity pathway analysis QIAGEN Version
81348237
Software, algorithm Imaris Bitplane
Software, algorithm Leica Application Suite (LAS X) Leica
Software, algorithm Zen Application Software Zeiss Pro 3.8
Other SomnoSuite Kent Scientific SS-01 Anesthesia
Other Povidone-Iodine Prep Pad PDI Healthcare B40600 Disinfection
Other Alcohol Prep, Sterile, Md, 2 Ply Covidien 6818 Disinfection
Other Fine Forceps Dumont #55 Dumoxel Roboz Surgical Instrument RS-5063 Surgical tool
Other 7 mm Reflex Wound Clips Cell Point Scientific 203-1000 Surgical tool
Other Micro Friedman Rongeur Roboz Surgical Instrument RS-8306 Surgical tool
Other McPherson-Vannas Micro Dissecting Spring scissors Roboz Surgical Instrument RS-5600 Surgical tool
Other COATED VICRYL (polyglactin 910) Suture Ethicon J463G Surgical suture
Other Dumont #7 curved forceps Fine Science Tools 11271-30 Surgical tool
Other Miltex Halsted mosquito forceps Integra LifeSciences 724 Surgical tool
Other Nanofil 10 µl syringe World Precision Instruments NANOFIL Small syringe
Other 36g beveled nanofil needle World Precision Instruments NF36BV-2 Perfusion
Other Non-absorbable sutures Ethicon 640G Surgical sutures for parabiosis
Other Absorbable sutures Ethicon J463G Surgical sutures
Sequence-based reagent RNAscope Probe- Mm-Gpnmb-C3-
Mus musculus glycoprotein (transmembrane) Gpnmb
(Gpnmb) mRNA
ACD Bio 489511-C3 1:50
Sequence-based reagent RNAscope Probe- Mm-Ccl8-C2-Mus musculus chemokine
(C-C motif) ligand 8 (Ccl8) mRNA
ACD Bio 546211-C2 1:50
Sequence-based reagent RNAscope Probe- Mm-Cd209a-C2- musculus CD209a antigen (Cd209a) mRNA ACD Bio 480311-C2 1:50
Commercial assay or kit RNAscope Multiplex
Fluorescent Reagent Kit v2
ACD Bio 323100
Other Model 1525 incubator VWR Scientific 1525 RNAscope equipment
Other ACD hybridization oven ACD Bio 321710 RNAscope equipment
Chemical compound, drug Hydrogen peroxide solution ACD Bio PN 322381
Chemical compound, drug 10× antigen retrieval solution ACD Bo 322000
Chemical compound, drug Protease Plus solution ACD Bio 322331
Chemical compound, drug Cy3 AKOYA Biosciences NEL744001KT 1:2000
Chemical compound, drug Cy5 AKOYA Biosciences NEL745001KT 1:2000
Chemical compound, drug DAPI mounting media Southern Biotech 0100-20
Chemical compound, drug RNAscope wash buffer ACD Bio 310091
Chemical compound, drug Formalin (1:10) Fisherbrand 427-098
Antibody PFKfb3
(rabbit monoclonal)
Cell Signaling Technology 13123 1:300
Antibody PKM
(rabbit polyclonal)
Abcam ab137791 1:300
Antibody Sox10
(goat polyclonal)
R&D Systems AF2864 1:300
Sequence-based reagent Spp1 Forward This paper PCR primer AAGTCTAGGAGTTTCCAGGTTTC
Sequence-based reagent Spp1 Reverse This paper PCR primer GCTCTTCATGTGAGAGGTGAG
Sequence-based reagent Gapdh Forward This paper PCR primer AACTTTGGCATTGTGGAAGG
Sequence-based reagent Gapdh Reverse This paper PCR primer GGATGCAGGGATGATGTTCT
Sequence-based reagent Chil3 Forward This paper PCR primer AGCCCTCCTAAGGACAAAC
Sequence-based reagent Chil3 Reverse This paper PCR primer GGAATGTCTTTCTCCACAGATTC
Sequence-based reagent Rlp13a Forward This paper PCR primer GCTGCTCTCAAGGTTGTTC
Sequence-based reagent Rlp13a Reverse This paper PCR primer GTACTTCCACCCGACCTC
Sequence-based reagent Hif1a Forward This paper PCR primer CTGATGGAAGCACTAGACAAAG
Sequence-based reagent Hif1a Reverse This paper PCR primer CAATATTCACTGGGACTGTTAGG
Sequence-based reagent Acod1 Forward This paper PCR primer GGCACAGAAGTGTTCCATAAAG
Sequence-based reagent Acod1 Reverse This paper PCR primer GTGGGAGCCTGAAGTCTG
Sequence-based reagent Il1b Forward This paper PCR primer CTTCCAGGATGAGGACATGAG
Sequence-based reagent Il1b Reverse This paper PCR primer TCACACACCAGCAGGTTATC
Sequence-based reagent Slc16a3 Forward This paper PCR primer GCAGAAGCATTATCCAGATCTAC
Sequence-based reagent Slc16a3 Reverse This paper PCR primer GATTGAGCATGATGAGGGAAG
Sequence-based reagent Ldha Forward This paper PCR primer CATTGTCAAGTACAGTCCACAC
Sequence-based reagent Ldha Reverse This paper PCR primer TTCCAAGCCACGTAGGTC
Sequence-based reagent Pkm Forward This paper PCR primer CTGGATACAAAGGGACCTGAG
Sequence-based reagent Pkm Reverse This paper PCR primer CAGAGTGGCTCCCTTCTTC
Sequence-based reagent Pgk1 Forward This paper PCR primer GTGGAATGGCCTTTACCTTC
Sequence-based reagent Pgk1 Reverse This paper PCR primer GACAATCTTGGCTCCTTCTTC
Sequence-based reagent Cd38 Forward This paper PCR primer ACTGTCCCAACAACCCTATTAC
Sequence-based reagent Cd38 Reverse This paper PCR primer ATCACTTGGACCACACCAC
Sequence-based reagent Pfkl Forward This paper PCR primer CTGCTGAGCTACACAGAGG
Sequence-based reagent Pfkl Reverse This paper PCR primer CGTGTCCCTTGGTGAGAAG
Sequence-based reagent Gatm Forward This paper PCR primer TTGCTTTGATGCTGCTGAC
Sequence-based reagent Gatm Reverse This paper PCR primer CACTCGATGCCCAGGTAG
Chemical compound, drug SYBR Green Fluorescein Master Mix Thermo Scientific 4364344
Other QuantStudio 3 real-time PCR system Applied Biosystems A28567 Genotyping
Other Pestle motor mixer RPI 299200 Tissue homogenization
Other Nanodrop Thermo Scientific Measurement of nucleic
acid concentration
Commercial assay or kit SuperScript III First-Strand
Synthesis System kit
Invitrogen 18080051
Chemical compound, drug RIPA buffer Sigma R0278 Supplemented with 50 mM BGP,
1 mM Na3VO4, and 1:100 PIC
Chemical compound, drug DC protein assay Bio-Rad 5000111
Chemical compound, drug β-Mercaptoethanol Sigma 60242
Chemical compound, drug 2X Laemmli buffer Bio-Rad 1610737
Other Immune-Blot PVDF membrane BioRad 1620260 Western blotting
Chemical compound, drug TBST blocking buffer This paper Buffer 48.4 g Tris Base, 351.2 g NaCl,
ddH2O 2 L, pH 7.4, 0.5% Tween-
20 with BSA 200 mg
Chemical compound, drug Bovine serum albumin Fisher BP1600-100
Chemical compound, drug SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher Scientific 34580