Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Recombinant Anti-Iba1 antibody [EPR16588] | Abcam | Cat# ab178846, RRID:AB_2636859 |
| Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 | Invitrogen | Cat# A-21245, RRID:AB_2535813 |
| Anti-NeuN Antibody, clone A60, Alexa Fluor®488 conjugated | Millipore Sigma | Cat# MAB377X, RRID:AB_2149209 |
| IRF8 Mouse anti-Human, PE, Clone: U31–644 | BD Biosciences | Cat# 566373, RRID:AB_2739716 |
| Recombinant Alexa Fluor® 647 Anti-Olig2 antibody [EPR2673] | Abcam | Cat# ab225100, RRID:N/A |
| Tri-Methyl-Histone H3 (Lys27) Rabbit mAb | Cell Signaling Technology | Cat# 9733, RRID:AB_2616029 |
| Anti-Histone H3 (tri methyl K9) antibody - ChIP Grade | Abcam | Cat# ab8898, RRID:AB_306848 |
| Bacterial and virus strains | ||
| One Shot Stbl3 Chemically Competent E. coli | NEB | Cat# C737303 |
| HIV: NL-43 GFP (NLGI) | Cohen et al., 1999 | N/A |
| Biological samples | ||
| Human brain specimens | The Manhattan HIV Brain Bank | https://icahn.mssm.edu/research/manhattan-hiv |
| Chemicals, peptides, and recombinant proteins | ||
| Penicillin-Streptomycin (10,000 U/mL) | Gibco | Cat#15140122 |
| Fetal Bovine Serum, 500 mL, Regular, USDA approved Origin (Heat Inactivated) | Corning | Cat#35–011-CV |
| Penicillin-Streptomycin-Glutamine (100X) | Gibco | Cat#10378016 |
| Polybrene | Milipore Sigma | Cat#TR1003G |
| Recombinant ribonuclease inhibitor | Takara Bio USA, Inc. | Cat#2313A |
| TrueBlack Lipofuscin Autofluorescence Quencher | Biotium | Cat#23007 |
| PureLink™ RNase A | Invitrogen | Cat#12091039 |
| SPRIselect for Size Selection | Beckman Coulter Life Sciences | Cat#B23318 |
| PolyJet™ In Vitro DNA Transfection Reagent | Cat#SL100688 | |
| Clontech Labs 3P Advantage® 2 Polymerase Mix | Clontech Labs | Cat#639201 |
| Pierce™ Protein A/G Magnetic Beads | Thermo Scientific | Cat#88803 |
| TRIzol™ LS Reagent | Invitrogen | Cat#10296028 |
| DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) | Invitrogen | Cat#D1306 |
| SYBR™ Green PCR Master Mix | Applied Biosystems | Cat#4309155 |
| Human IFN-γ1b research grade | Miltenyi Biotec | Cat#130–096-873 |
| VECTASHIELD Antifade Mounting Medium with Propidium Iodide (PI) | Vector Laboratories | Cat#H-1300–10 |
| Opal 570 Reagent Pack | Akoya Biosciences | Cat#FP1488001KT |
| Critical commercial assays | ||
| Arima-HiC Kit | Arima Genomics | Cat#A51008 |
| Plasmid Midi Kit | Qiagen | Cat#12143 |
| RNA Clean & Concentrator-5 kit | Zymo Research | Cat#R1013 |
| SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian | Takara Bio USA, Inc. | Cat#634412 |
| RNAscope Multiplex Fluorescent v2 Assay | Advanced Cell Diagnostics | Cat#323110 |
| Chromium Next GEM Single Cell 3’ Kit v3.1 | 10x Genomics | Cat#1000268 |
| Chromium Next GEM Chip G Single Cell Kit | 10x Genomics | Cat#1000120 |
| Dual Index Kit TT Set A | 10x Genomics | Cat#1000215 |
| SuperScript™ IV First-Strand Synthesis System | Invitrogen | Cat#18091050 |
| Swift Biosciences® Accel-NGS® 2S Plus DNA Library Kit | Swift Biosciences, Inc | Cat#21024 |
| Kapa Hyper Prep Kit | Roche | Cat#07962347001 |
| DNeasy Blood & Tissue Kit | Qiagen | Cat#69504 |
| NEBNext® Ultra™ II End Repair/dA-Tailing Module | New England Biolabs | Cat#E7546S |
| NEBNext® Ultra™ II Ligation Module | New England Biolabs | Cat#E7595S |
| KAPA Library Quantification Kit | Roche | Cat#KK4873 |
| End-It DNA End-Repair Kit | Biosearch Technologies | Cat#ER0720 |
| Exo-Minus Klenow DNA Polymerase | Biosearch Technologies | Cat#KL11101K |
| Fast-Link kit | Biosearch Technologies | Cat#LK0750H |
| TruSeq ChIP Library Preparation Kit | Illumina | Cat#IP-202–1012 |
| Deposited data | ||
| Raw sequencing data | This paper | dbGaP phs003080.v1.p1 |
| Code | This paper | doi:10.17632/ccj4trmsxc.1 |
| Experimental models: Cell lines | ||
| HMC3 | ATCC | Cat#CRL-3304 |
| Human T Lymphocyte, J-Lat Full Length Cells (8.4) | NIH HIV Reagent Program | Cat#ARP-9847 |
| Human T Lymphocyte, J-Lat Full-Length Cells (9.2) | NIH HIV Reagent Program | Cat#ARP-9848 |
| Human T Lymphocyte, J-Lat Full Length Cells (10.6) | NIH HIV Reagent Program | Cat#ARP-9849 |
| Human T Lymphocyte, J-Lat Full Length Cells (15.4) | NIH HIV Reagent Program | Cat#ARP-9850 |
| Jurkat | NIH HIV Reagent Program | Cat#ARP-177 |
| HEK293T | ATCC | Cat#CRL-3216 |
| Oligonucleotides | ||
| Probe-V-HIV1-gagpol-sense-C2 | Advanced Cell Diagnostics | Cat#317701-C2 |
| Probe-V-HIV1-gagpol | Advanced Cell Diagnostics | Cat#317691 |
| HIV integration site sequencing oligos, see Supplementary Table 1 | Sherman et al., 2017 | N/A |
| Primer: GAPDH Forward: GTCTCCTCTGACTTCAACAGCG | sequence from Origene, ordered from IDT | CAT#: HP205798 |
| Primer: GAPDH Reverse: ACCACCCTGTTGCTGTAGCCAA | sequence from Origene, ordered from IDT | CAT#: HP205798 |
| Primer: HLA-A Forward: CAGACGCCGAGGATGGCC | Huang et al., 2004 | N/A |
| Primer: HLA-A Reverse: CACACAAGGCAGCTGTCTCACA | Huang et al., 2004 | N/A |
| Primer: HLA-DRa Forward: CGAGTTCTATCTGAATCCTG | Wu et al., 1999 | N/A |
| Primer: HLA-DRa Reverse: GTTCTGCTGCATTGCTTTTGC | Wu et al., 1999 | N/A |
| Primer: STAT1 Forward: ACTCAAAATTCCTGGAGCAG | Zuo et al., 2020 | N/A |
| Primer: STAT1 Reverse: ACGCTTGCTTTTCCTTATGTT | Zuo et al., 2020 | N/A |
| Primer: STAT2 Forward: ATGCTGCAGAATCTTGACA | Zuo et al., 2020 | N/A |
| Primer: STAT2 Reverse: TAGTTCAGCTGATCCAAGAAG | Zuo et al., 2020 | N/A |
| Software and algorithms | ||
| Cell Ranger | 10X Genomics | https://support.10xgenomics.com/single-cell-gene-expression/software/overview/welcome |
| Debris Identification using Expectation Maximization | Alvarez et al., 2020 | https://github.com/marcalva/diem |
| DoubletFinder | McGinnis et al., 2019 | https://github.com/chris-mcginnis-ucsf/DoubletFinder |
| Seurat | Butler et al., 2018 | https://github.com/satijalab/seurat |
| Harmony | Broad Institute | https://portals.broadinstitute.org/harmony/ |
| DESeq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| ShinyGO | Ge et al., 2020 | http://bioinformatics.sdstate.edu/go/ |
| TrimGalore | Braham Informatics | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ |
| STAR | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| Bowtie2 | Langmead et al., 2012 | https://github.com/BenLangmead/bowtie2 |
| HiC-Pro | Servant et al., 2015 | https://github.com/nservant/HiC-Pro |
| plotgardener | Kramer et al., 2022 | https://phanstiellab.github.io/plotgardener/ |
| dcHiC | Chakraborty et al., 2022 | https://github.com/ay-lab/dcHiC |
| matrix2insulation.pl | Dekker Lab | https://github.com/dekkerlab/cworld-dekker |
| MACS2 | Zhang et al., 2008 | https://github.com/macs3-project/MACS |
| HiCPeaks | Rao et al., 2014 | https://github.com/XiaoTaoWang/HiCPeaks |
| ROSE: Rank Ordering of Super-Enhancers | Young Lab | http://younglab.wi.mit.edu/super_enhancer_code.html |
| Cutadapt | Rahmann Lab | https://cutadapt.readthedocs.io/en/stable/ |
| ChIPseeker | Guangchuang et al., 2015 | https://guangchuangyu.github.io/software/ChIPseeker/ |