Skip to main content
Helminthologia logoLink to Helminthologia
. 2022 Dec 17;59(3):311–316. doi: 10.2478/helm-2022-0025

First Report of Tripylina Zhejiangensis Associated with Grassland in South Africa

E Shokoohi 1,*
PMCID: PMC9831513  PMID: 36694827

Summary

Specimens of Tripylina zhejiangensis, collected from natural grass in the Free State Province of South Africa, were identified morphologically and molecularly. This species characterizes by body length (1037 – 1128 μm), a = 27.3 – 35.3, b = 5.1 – 5.6, c = 16.1 – 19.8, c’ = 2.5 – 3.4, V = 62 – 65. Molecular analysis was also undertaken, based on the 28S rDNA regions, and confirmed this population as T. zhejiangensis. Phylogenetic analysis using the Bayesian inference method, places this population in a clade close to T. zhejiangensis with a 1.00 posterior probability value. According to the knowledge, this is the first report of the genus Tripylina and its species from South Africa. Besides, this is the second report of T. zhejiangensis worldwide after the original description from China.

Keywords: South Africa, grass, Tripylina, morphology, rDNA, phylogeny

Introduction

The genus Tripylina established by Brzeski, 1963 and it is represented by free-living, predacious species that inhabit soil, litter, moss, and other semi-wet biotopes (Andrássy, 2007; Zhao, 2009; Xu et al., 2013). This genus currently includes 22 valid species described from different regions of the world (Renčo et al., 2021). Besides, this genus members have been studied from all continents (Yeates, 1972; Tsalolikhin, 1983; Brzeski & Winiszewska-Ślipińska, 1993; Andrássy, 2008; Zhao, 2009; Cid del Prado-Vera et al., 2010; Tahseen & Nusrat, 2010; Cid del Prado-Vera et al., 2012, 2016; Renčo et al., 2021). Tripylina spp. are characterized by having six long and four short cephalic setae in a single whorl, a prodelphic and reflexed gonad without a post-vulval sac, and curved tails in both sexes (Zullini, 2006). Despite some species such as T. bravoe Cid del Prado-Vera, Ferris, Nadler and Lamothe-Argumedo, 2012; T. iandrassyi Cid del Prado-Vera, Ferris and Nadler, 2016, T. longa Brzeski and Winiszewska-Ślipińska, 1993 and re-described materials of an original description of T. gorganensis Asghari, Pourjam, Heydari, Zhao and Ramaji, 2012 studied by Renčo et al. (2021) have a post-vulval sac (Cid del Prado-Vera et al., 2016). Tripylina members were divided into two groups based on the position of the sub ventral teeth by Zhao (2009). Despite various research done on free-living nematodes, Tripylina species have not been reported yet from South Africa. Tripylina zhejiangensis Pham, Wang, Zhao and Zheng, 2013 has been described from China. Therefore, the aims of the present work were 1) to study the morphology of T. zhejiangensis, and 2) to study the molecular characters of T. zhejiangensis using 28S rDNA markers.

Materials and Methods

Nematode extraction, processing, and LM pictures

Specimens were collected at Parys, Free State Province, close to the river in association with the natural grass (S 26° 54’ 37.336”, E 27°27’ 24.582”). The specimens were extracted using the tray method and were fixed with a hot 4 % formaldehyde solution and transferred to anhydrous glycerin using the De Grisse (1969) method. The nematodes were processed and studied at Aquacultutre Research Unit, University of Limpopo. The classification provided by Zhao (2009) was used for the taxonomical study of Tripylina spp. Pictures were taken with a Nikon Eclipse 80i light microscope equipped with a digital camera (Nikon, Tokyo, Japan). The LM taken was used for the line illustration. The line illustration was edited using Adobe® Photoshop® CS.

DNA extraction, PCR, and phylogenetic analysis

DNA extraction was done using the Chelex method (Straube & Juen, 2013). Five specimens of the species were hand-picked with a fine tip needle and transferred to a 1.5 ml Eppendorf tube containing 20 μl double distilled water. The nematodes in the tube were crushed with the tip of a fine needle and vortexed. Thirty microliters of 5 % Chelex® 50 and 2 μL of proteinase K was added to the microcentrifuge tube that contained the crushed nematodes and mixed. The microcentrifuge tube with the nematode lysate was incubated at 56 °C for two hours and then incubated at 95 °C for 10 minutes to deactivate the proteinase K and finally spun for 2 min at 16000 rpm (Shokoohi, 2021). The supernatant was then extracted from the tube and stored at –20 °C. Following this step, the forward and reverse primers, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999), were used in the PCR reactions for partial amplification of the D2/D3 region of 28S. PCR was conducted with 8 μl of the DNA template, 12.5 μl of 2X PCR Master Mix Red (Promega, USA), 1 μl of each primer (10 pmol μl-1), and ddH2O for a final volume of 30 μl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94 °C, 37 cycles of denaturation for 45 s at 94 °C; 56 °C annealing temperature for 45 s and 72 °C for 1 min, and finally an extension step of 6 min at 72 °C followed by a temperature on hold at 4 °C. After DNA amplification, 4 μl of PCR product was loaded on a 1 % agarose gel in TBE buffer (40 mM Tris, 40 mM boric acid, and one mM EDTA) for evaluation of the DNA bands. The band was stained with RedGel and visualized and photographed on a UV transilluminator. The PCR product was stored at –20 °C. Finally, Inqaba Biotech (South Africa) purified the PCR product for sequencing.

The ribosomal DNA sequences were analyzed and edited with BioEdit (Hall, 1999) and aligned using CLUSTAL W (Thompson et al., 1994). Phylogenetic tree was generated using the Bayesian inference method as implemented in the program Mr Bayes 3.1.2 (Ronquist & Huelsenbeck, 2003). The GTR+I+Γ model was selected using jModeltest 2.1.10 (Guindon & Gascuel, 2003; Darriba et al., 2012). Analysis was initiated with a random starting tree and ran with the Markov chain Monte Carlo (MCMC) for 106 generations for 28S rDNA. The tree was visualized with the TreeView program. Also, as outgroups, Dorylaimus stagnalis (MF125467, MF125468) were selected based on Pham et al. (2013). The original partial 28S rDNA sequence of T. zhejiangensis was deposited in GenBank under the accession number OM891776.

Ethical Approval and/or Informed Consent

The author confirms that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered. The author confirms that the conducted research is neither related to human nor animal use.

Results

Tripylina zhejiangensis Pham, Wang, Zhao & Zheng, 2013

Morphological characterization (ten females in a good state of preservation)

Fig. 1; Table 1

Fig. 1.

Fig. 1

Tripylina zhejiangensis Pham, Wang, Zhao and Zheng, 2013. (A) anterior end; (B) lip region; (C) entire body; (D) pharyngeal-intestinal junction; (E) female posterior end; (F) female reproductive system.

Table 1.

Measurements of females of Tripylina zhejiangensis from South Africa. All measurements are in μm and in the form: mean ± SD (range), except for the ratio.

Character Present study South Africa Pham et al., 2013 China
n 10 females 23 females
L 1075.0 ± 36.5 (1037 – 1128) 1152 – 1631
a 31.0 ± 3.3 (27.3 – 35.5) 23.3 – 36.4
b 5.4 ± 0.2 (5.1 – 5.6) 5.0 – 6.6
c 18.2 ± 1.8 (16.1 – 19.8) 13.4 – 19.7
c' 3.0 ± 0.4 (2.5 – 3.4) 2.6 – 3.6
V 64.0 ± 1.2 (62 – 65) 60 – 70
Lip region width 17.6 ± 1.0 (16 – 19) 19 – 30
Labial setae 11.4 ± 1.7 (10 – 15) 11 – 16
Dorsal tooth from the anterior end 14.5 ± 3.2 (10 – 20) 11 – 21
Amphid position from the anterior end 13.5 ± 0.7 (13 – 14) 12 – 17
Nerve ring from the anterior end 87.6 ± 2.1 (85 – 90) 99 – 139
Pharynx 170.1 ± 10.5 (155 – 186) 163 – 164*
Neck length 198.7 ± 6.1 (187 – 204) 183 – 186*
Cardia length 20.6 ± 3.1 (18 – 26) 20 – 27
Cardia diameter 7.3 ± 2.1 (5 – 9) 8.5 – 14
Body diameter at neck base 30.8 ± 4.0 (25 – 37) 34 – 36*
Body diameter at mid-body 33.7 ± 2.8 (25 – 38) 43*
Body diameter at anus 21.0 ± 2.4 (17 – 24) 23 – 29*
Tail length 61.2 ± 8.6 (53 – 72) 73 – 103
Anterior end to vulva 696.4 ± 49.5 (653 – 776) 757 – 1045

* = extracted from original drawing

Description

Female: Body ventrally arcuate after heat relaxation, moderately large, robust, posterior region more curved than anterior. Cuticle smooth, not striated, with numerous body pores along entire body. Six long (10 – 15 μm) and four short cephalic setae (5 – 7 μm) in a single whorl. Lip region rounded, continuous with body contour, 16 – 19 μm width. Lip region dome-shaped, with three triangular lips, inner labial papillae conical, outer labial setae. Thick stomatal walls, with a large triangular dorsal tooth in a stomatal chamber, pointing towards ventral side. Stoma 18 – 30 μm long, 1 – 3 μm width. Two triangular subventral teeth located posterior to dorsal tooth (Fig 1B). Tooth length 1 – 2 μm, tooth width 0.5 – 0.8 μm. Amphids cup-like, located at 13 – 14 μm from anterior end. Amphidal aperture diameter 2.8 – 3.3 μm. Excretory pore not observed. Nerve ring 85 – 90 μm or 43 – 47 % of neck length from anterior end of body. A prominent cardia separates the pharynx and intestine, 18 – 26 μm long and 5-9 μm wide. Pharyngo-intestinal valve composed of three glands around anterior portion of intestine. An ingested nematode was observed within the intestine of one specimen of this species. Female genital system mono-prodelphic without post-vulval sac. Vulva simple, lacking protuberant lips, vagina 5 – 9 μm long. Vulva-anus distance 278 – 319 μm. Rectum 16 – 23 μm long. Tail bent ventrad, a pair of subdorsal caudal setae on anterior part of tail, three tandem caudal glands, a terminal spinneret, 3 – 4 μm long.

Male: not found

Remarks: The South African population of T. zhejiangensis resembles the original description studied in China (Pham et al., 2013). However, compared with the Chinese population, they differ in body length (1037 – 1128 vs 1152 – 1631 μm), amphid from anterior end (13 – 17 vs 12 – 17 μm), and tail length (53 – 72 vs 73 – 103 μm).

Discussion

The forward D2 and reverse D3 primers of 28S rDNA for T. zhejiangensis isolated 722 base pairs long. The nBlast test of 28S rDNA showed 99 % similarity of the test population with the Chinese population of T. zhejiangensis (KC008577) with only one base pair difference. Compared with the Iranian sequences of T. zhejiangensis (KY115144; KY115147), it showed 99 % similarity with one and three base pairs differences, respectively.

Our phylogenetic analysis using 28S rDNA, placed the South African T. zhejiangensis population in a clade together with other T. zhejiangensis populations with 1.00 posterior probability values (Fig. 2). Findings in the current study were in agreement with the phylogenies of Tripylina species studied (Zhao, 2009; Pham et al., 2013; Renčo et al., 2021). Two permanent microscope slides containing the females of T. zhejiangensis were deposited in the Aquaculture Research Unit of the University of Limpopo, South Africa. According to the literature, this is the first record of T. zhejiangensis in South Africa. In conclusion, the morphometrical variation that exists between the T. zhejiangensis (e.g., vulva position, tail length, body length) is due to the geographical location of the population.

Fig. 2.

Fig. 2

28S rDNA Bayesian tree inferred from known and newly sequenced Tripylina zhejiangensis from South Africa.

References

  1. Andrássy I.. Two new and a known species of the family Tripylidae (Nematoda: Enoplida) from the tropics. Opusc Zool Budapest. 2008;37:3–9. [Google Scholar]
  2. Andrássy I. Csuzdi C., Mahunka S. Pedozoologica Hungarica, 4. Hungarian Natural History Museum and Systematic Zoology Research Group of the Hungarian Academy of Sciences; Budapest: 2007. Free-living nematodes of Hungary, II (Nematoda errantia) [Google Scholar]
  3. Asghari R., Pourjam E., Heydari R., Zhao Z.Q., Ramaji F.A.. Tripylina gorganensis n. sp. (Triplonchida: Tripylidae) from northern Iran. Nematology. 2012;14:613–621. doi: 10.1163/156854112X624609. [DOI] [Google Scholar]
  4. Brzeski M.W.. Nematode genera of the family Tripylidae (Nematoda, Enoplida) Acta Zool Cracoviensia. 1963;8:295–308. [Google Scholar]
  5. Brzeski M.W., Winiszewska-Ślipińska G.. Taxonomy of Tripylidae (Nematoda: Enoplia) Nematologica. 1993;39:12–52. [Google Scholar]
  6. Cid del Prado Vera I., Ferris H., Nadler S. A., Lamothe-Argumedo R.. Four new species of Tripylina Brzeski, 1963 (Enoplida: Tripylidae) from Mexico, with an emended diagnosis of the genus. J Nematode Morphol System. 2012;15:71–86. [Google Scholar]
  7. Cid del Prado-Vera I., Ferris H., Nadler S.A.. Soil inhabiting nematodes of the genera Trischistoma, Tripylina and Tripyla from Mexico and the USA with descriptions of new species. J. Nematode Morphol System. 2010;13:29–49. [Google Scholar]
  8. Cid del Prado-Vera I., Ferris H., Nadler S. A.. Five new species of the family Trischistomatidae (Nematoda: Enoplida) from North and Central America, with keys to the species of Trischistoma and Tripylina. Zootaxa. 2016;4109:173–197. doi: 10.11646/zo-otaxa.4109.2.4. [DOI] [PubMed] [Google Scholar]
  9. Darriba D., Taboada G.L., Doallo R., Posada D.. jModel-Test 2: more models, new heuristics and parallel computing. Nat Methods. 2012;9:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. De Grisse A.. Redescription ou modifications de quelques techniques utililisés dans l’étude des nématodes phytoparasitaires [Redescription or modifications of some techniques used in the study of plant parasitic nematodes] Mededelingen van de Rijksfaculteit Landbouwetenschappen Gent. 1969;34:351–369. doi: 10.1163/156854199508559. (In French) De Ley, P., Felix, M.A., Frisse, L.M., Nadler, S.A., Sternberg, P.W., Thomas, W.K. (1999): Molecular and morphological characterisation of two reproductively isolated species with mirror-image anatomy (Nematoda: Cephalobidae). Nematology, 2: 591–612. [DOI] [Google Scholar]
  11. Guindon S., Gascuel O.. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Sys Biol. 2003;52:696–704. doi: 10.1080/10635150390235520. [DOI] [PubMed] [Google Scholar]
  12. Hall T.A.. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–98. [Google Scholar]
  13. Pham T.H., Wang H.T., Zhao Z.Q., Zheng J.W.. A new species of the genus Tripylina Brzeski, 1963 (Nematoda: Enoplida: Trischistomatidae) from Zhejiang Province, eastern China. Zootaxa. 2013;3717:158–168. doi: 10.11646/zootaxa.3717.2.2. [DOI] [PubMed] [Google Scholar]
  14. Renčo M., Rybarczyk-Mydłowska K., Flis Ł., Kubicz M., Winiszewska G.. Morphological and molecular characterisation of Tripylina gorganensis from the Slovak Republic as a contribution to the redescription of the species. J Nematol. 2021;53:1–10. doi: 10.21307/jofnem-2021-048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ronquist F., Huelsenbeck J.. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:15721574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  16. Shokoohi E.. First report of Bitylenchus ventrosignatus (Tobar Jiménez, 1969) Siddiqi, 1986 associated with wild grass in Botswana. J Nematol. 2021;53:1–9. doi: 10.21307/jofnem-2021-037. doi: 10.21307/jofnem-2021-037. Straube, D., Juen, A. (2013): Storage and shipping of tissue samples for DNA analyses: A case study on earthworms. Eur J Soil Biol 57 13-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Tahseen Q., Nusrat T.. Some new and known species of genera Tripylina Brzeski and Trischistoma Cobb, 1913 (Nematoda) with a discussion on their relationships. J Nematol. 2010;42:128–138. doi: 10.1093/nar/22.22.4673. Thompson, J.D., Higgins, D.G., Gibson, T.J. (1994): CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Tsalolikhin S.J. Nematodes of the families Tobrilidae and Tripylidae of the World Fauna. Leningrad, Russia, Nauka: 1983. p. 232. pp. (In Russian) [Google Scholar]
  19. Xu Y.M., Zhao Z.Q., Wang J.M., Zheng J.W.. A new species of the genus Tripylina Brzeski, 1963 (Nematoda: Enoplida: Trischistomatidae) from Shanxi province, China. Zootaxa. 2013;3630:561–570. doi: 10.11646/zootaxa.3630.3.10. [DOI] [PubMed] [Google Scholar]
  20. Yeates G.W.. Trischistoma stramenti n. sp. (Nematoda: Enoplida) from leaf litter. New Zeal J Sci. 1972;14:578–900. [Google Scholar]
  21. Zhao Z.Q.. A review of the genus Tripylina Brzeski, 1963 (Nematoda: Triplonchida), with descriptions of five new species from New Zealand. Zootaxa. 2009;2238:1–24. doi: 10.11646/zo-otaxa.2238.1.1. [DOI] [Google Scholar]
  22. Zullini A. Eyualem A., Andrássy I., Traunspurger W. Freshwater Nematodes: Ecology and Taxonomy. CABI Publishing; Wallingford, UK,: 2006. Order Triplonchida; pp. 293–325. [Google Scholar]

Articles from Helminthologia are provided here courtesy of De Gruyter

RESOURCES