. 2022 Sep 15;1121:175–210. doi: 10.3897/zookeys.1121.89539

Table A2.

List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension, and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.

Locus	Primer	Sequence (5’-3’)	Reference	PCR profile
16S	16Sar-L	CGCCTGTTTATCAAAAACAT	Palumbi et al. (1991)	30 cycles of 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min)
16S	16Sbr-H-R	CCGGTCTGAACTCAGATCACGT	Palumbi et al. (1991)	30 cycles of 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min)
Cytb	L14910	GACCTGTGATMTGAAAACCAYCGTTGT	Burbrink et al. (2000)	94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30–36]
Cytb	H16064	CTTTGGTTTACAAGAACAATGCTTTA	Burbrink et al. (2000)	94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30–36]
ND4	ND4	CACCTATGACTACCAAAAGCTCATGTAGAAGC	Arévalo et al. (1994)	94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25–30]
	Leu	CATTACTTTTACTTGGATTTGCACCA
	S78	CCTTGGGTGTGATTTTCTCACCT