Abstract
Background:
The adeABC efflux pump has a crucial role in the resistance of Acinetobacter baumannii strains to antimicrobial agents; it is encoded by adeABC, adeR, adeS genes. We evaluated antibiotic resistance, efflux pump genes, clonal relationships, and analyzed a probable correlation that can exist between antibiotic resistance and the aforementioned genes.
Methods:
We conducted this study on 27 food-originated and 50 human clinical Acinetobacter spp. in Southern Türkiye. MALDI-TOF system and disc diffusion/agar dilution (colistin) methods were used for the identification and antibiotic susceptibility. The efflux pump genes and genetic relatedness of the two groups were investigated by (PCR) and (PFGE) methods.
Results:
Foodborne A. dijkshoorniae strain was multidrug- resistant (MDR), and none of them resistant to colistin. Most of the clinical isolates (92%) were Extensive-Drug Resistant (XDR); highest resistant to ceftazidime, piperacillin-tazobactam, and imipenem (47, 94%), and were lowest to colistin (7, 14%), respectively. adeABC, and adeR, adeS genes were (23, 85.2%), (9, 33.3%), (27, 100%) and (10, 37.3%), (18, 66.7%) in foodborne strains respectively. These rates were (43, 86%), (48, 96%), (50, 100%), and (34, 68%), (48, 96.7%) in clinical strains respectively. A positive correlation existed between adeA gene positivity and piperacillintazobactam, ceftazidime, gentamycin, imipenem (P=0.048), amikacin (P=0.007) and trimethoprimsulfamethoxazole (P=0.029) resistance in clinical strains. A positive correlation of trimethoprimsulfamethoxazole resistance and adeS gene positivity was seen in foodborne strains (P=0.018).
Conclusion:
Multiple-efflux pump genes rise in parallel to multidrug-resistance in clinical isolates, while susceptible to diverse antibiotics; food may be a potential provenance for the dissemination of adeABC, adeR and adeS genes.
Keywords: Acinetobacter spp., Efflux pump, Gene
Introduction
Acinetobacter spp. are a Gram-negative genus, frequently found in the food industry. These bacteria can survive in numerous places; aquaculture or many outdoor environments (soil, water, and sewage) exhibits metabolic versatility, grows at low temperatures, and can form biofilms (1,2). In the last decades, A. baumannii has been the most common nosocomial infection agent, especially in intensive care units. Additionally, because of inappropriate/overdose antibiotic usage in agriculture, aquaculture, veterinary and medical areas, and the extension of A. baumannii Multi-Drug Resistant (MDR) strains, its morbidity and mortality have increased around the world (3).
It causes serious infections such as pneumonia, sepsis, urinary infections, wound infections, and even causes infections that result in death. Therefore, it has been considered one of ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, A. baumannii, Pseudomonas aeruginosa, and Enterobacter spp.), microorganisms by the WHO and it has been recommended to conduct epidemiological studies around the world (4,5). MDR in this species is mainly due to the horizontal acquisition of resistance genes. However, chromosomal gene expression for efflux systems, which play an important role in MDR, has increased in recent studies (5). The overexpression of the adeABC efflux pump is associated with carbapenem and cephalosporin resistance of A. baumannii. The adeABC is a three-component flow pump, a member of the Resistance-Nodulation-Split (RND) family. The AdeB component expels antibiotics from the cell, while adeA is a membrane fusion protein and AdeC is an outer membrane protein. The function of the adeABC flow pump is regulated by the adeRS two-component system. Point mutations in the adeRS operon can lead to increased expression of the efflux pump and thus to antibiotic resistance. Other efflux pumps; adeIJK and abeM have also been shown to contribute to imipenem and cephalosporin resistance (2,5).
It is crucial to regulate natural genes in adapting to changing environmental conditions and to obtain useful genes from the environment so the bacteria can survive. Similarly, A. baumannii has acquired several resistance determinants such as transposons, plasmids, genomic islands (GIs), insertion sequences (IS), and integrons from its environment by the way of horizontal gene transfer observed in its genome analyses (3,5). Acinetobacter spp. have also been reported in various foods and food-producing animals, which might constitute an unobserved source of bacterial pathogens to the human population. Although there are many studies on these resistance mechanisms/genes in clinical A. baumannii strains, there are fewer studies on whether these resistance mechanisms of the food chain are involved in the spreading of the resistance genes (4,5–7).
In this study, five efflux pump genes (adeA, adeB, adeC, adeR, and adeS) were evaluated in 50 A. baumannii strains of clinical origin and 27 food-borne Acinetobacter spp. In addition, it was statistically examined whether there was any correlation between adeABC, adeR, and adeS genes frequency and the antibiotic resistance in all strains. Moreover, the study at hand has checked whether the food and clinically derived A. baumannii strains were clonally related or not before undergoing genotypically comparisons with the PFGE method. To the best of our knowledge, this is the first study about this subject in our country.
Materials and Methods
Ethics approval
The Turkish Republic, University of Cukurova, Faculty of Medicine Ethical Board of Scientific Research’ approved an etic report for this study with 89 decision code numbers on 14.06.2019.
Statistical analysis
The S-PLUS 20 statistics program (S-PLUS 20.00 for Windows, Professional Edition) was used. The chi-square test (Fisher’s exact test and, where appropriate, Mann-Whitney U tests) was used to compare categorical measures (phenotypic and genotypic experiments) between the groups. A P value of <0.05 was considered statistically significant.
Bacterial strains and growth conditions
In the present study, 27 Acinetobacter spp. were isolated and identified from 102 food samples [n=39 fruit and vegetables, n=25 cheese, n=17 sucuk, n=13 chicken meat, and n=8 veal] purchased in 12 markets from 2019 Mar to Sep 2021. Clinical strains were collected over a period of 3 years (2019–2021) from clinical laboratories of the Department of Medical Microbiology, University of Çukurova (Türkiye). One isolate from each patient was collected from infected hospitalized patients (n=50).
Isolation and identification of foodborne and clinical Acinetobacter spp.
Isolation of foodborne isolates was evaluated, as described (5,6). Further species-level identification of isolates with a typical Acinetobacter spp. morphology on Tryptone Soy Agar (TSA) plates containing 5% sheep blood (Oxoid) media were fulfilled by biochemical tests; catalase production, Gram staining, motility, and oxidase tests. The presumptive colonies were identified using a matrix-assisted laser desorption ionization time-of-flight mass spectrometer (MALDI-TOF) (Bruker, Germany) (8). Clinical isolates were grown on Mac Concey and Columbia agar (Becton-Dickinson, Sparks, MD) supplemented with 5% defibrinated sheep blood (Oxoid). For identification, cultures were examined with MALDI-TOF automated identification system. The bla OXA-51 gene carriage was analyzed for confirmation of A. baumannii with the PCR method.
Detection of Oxa-51 and adeABC, adeR and adeS efflux pump genes
The boiling method was used to extract the genomic DNA previously described (9). In order to quantify the DNA samples (100ng/μL DNA for each sample), a spectrophotometer (UV-VIS Spectrophotometer CHEBIOS) was used. Multiplex PCR was performed to screen specific oxa-51, adeABC, adeR, and adeS genes as described previously (10,11). Specific primers are presented in Table 1.
Table 1:
List of primers used in the present study
| Genes | Primers sequence (5’-3’) | Product size (bp) | Reference |
|---|---|---|---|
| oxa-51 | F:GACCGAGTATGTACCTGCTTCGACC | 497 | (10) |
| R:GAGGCTGAACAACCCATCCAGTTAACC | |||
| adeA | F:GAAATCCGTCCGCAAGTC | 683 | |
| R:ACACGCACATACATACCC | |||
| adeB | F:AAAGACTTCAAAGAGCGG | 623 | |
| R:TCACGCATTGCTTCACCC | (11) | ||
| adeC | F:ATTTCAGGTCGTAGCATT | 370 | |
| R:TTGATAAGTAGAGTAGGGATT | |||
| adeR | F:AGATTTCATCTTTGATTCTTGG | 557 | |
| R:AATTGATTCTTAGCATCTGG | |||
| adeS | F:ACTCGGGGATTGATAGGC | 829 | |
| R:GCTGCTAAAGCTGCGCTT |
The PCR mix to be used for one sample: In a total volume of 50 μL, PCR was performed. Each reaction contained 25 mM of MgCl2, 5 μL of 10X PCR buffer, 5 units/μL of Taq DNA polymerase (Fermentas-Lithuania), 1.25 mM of the dNTPs mix, 10 μM of reverse and forward primers, and 5 μL of template DNA. The remainder for each reaction was made up to 50 μL with water. The thermal profile involved 3 min at 94 °C (for oxa-51; 4 min) for initial denaturation step, 40 cycles of 30 sec at 94 °C (for oxa-51; 35 cycles), primer annealing temperature was set up for oxa-51, adeA, adeB, adeC and adeS at 55 °C for 30 sec, for adeR at 52 °C for 30 sec. The extension was also set up at 72 °C for 40 sec (for oxa-51; 1 min). The cycling was done according to a final extension step at 72 °C for 10 min (for oxa-51; 7 min). PCR products were analyzed by 2% agarose gel and stained with ethidium bromide.
Antibiotic susceptibility analysis
For this purpose, Kirby-Bauer disk diffusion method using 9 discs and including ciprofloxacin (CIP, 5 μg), piperacillin-tazobactam (TZP 100/10 μg), ceftazidime (CAZ, 30 μg), imipenem (IPM, 10 μg), meropenem (MEM, 10 μg), amikacin (AK, 30 μg), trim./süfometaksazol (10 μg), gentamicin (10 Μg), and tetracycline (30 Μg), (all discs from Oxoid Ltd.). Susceptibility or resistance was determined according to the recommendation of (CLSI) guidelines (12). An index strain of A. baumannii (CLI-74) that nosocomial infection agent was used as a reference strain in antibiotic resistance and genotyping tests obtained from the Medical Microbiology Laboratory. Colistin (CL) susceptibility was determined by the broth microdilution method according to EUCAST guidelines (13,14).
Minimal inhibitory concentration (MIC) testing
The MICs of tested antibiotics were determined with the disk diffusion method (Biodisk, Solana, Sweden) according to the CLSI’s(12) guidelines. For colistin, MIC was determined by the broth microdilution protocol according to the CLSI and EUCAST. Escherichia coli ATCC 25922 was used as a quality control strain. Isolates with a MIC ≤ of 2 μg/L for colistin were considered susceptible (13,14).
Pulsed-field Gel electrophoresis (PFGE) analysis
A macrorestriction analysis of chromosomal DNA with ApaI (New England Biolabs, Boston, Mass.) was evaluated with the PFGE method previously described (15).
Results
Overall, 27 Acinetobacter spp. were identified from 102 food samples (Table 2). Fifty clinical isolates were identified A. baumannii. These strains were isolated from aspiration fluid samples (n=14, 28%), wound (n=11, 22%), blood (n=8, 16%), urine (n=7, 14%), and other samples (n=10, 20%) respectively.
Table 2:
Antibiotic resistance profile among Acinetobacter spp. (n=77)
| Species No.(%) | SXT | CIP | TZP | TE | AK | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | |
| A. Baumannii(50) | 44(88) | 3(6) | 3(6) | 45(90) | 2(4) | 3(6) | 47(94) | 3(6) | 46(92) | 1(2) | 3(6) | ||||
| Total(50) | 44(88) | 3(6) | 3(6) | 45(90) | 2(4) | 3(6) | 47(94) | 3(6) | 46(92) | 1(2) | 3(6) | ||||
| A. Baumannii(14 ) | 2(14.3) | 2(14.3) | |||||||||||||
| A. Baylyi(1) | |||||||||||||||
| A. bereziniae (2) | |||||||||||||||
| A. Calcoaceticus(1) | |||||||||||||||
| A. dijkshoorniae (2) | 1(50) | 1(50) | |||||||||||||
| A. pittii(5) | 1(20) | ||||||||||||||
| A. schindleri (1) | |||||||||||||||
| A.tandoi(1) | |||||||||||||||
| Total(27) | 2(7.4) | 2(7.4) | 3(11.1) | ||||||||||||
| Species No.(%) | MEM | CL | CAZ | CN | IMP | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | |
| A. Baumannii(50) | 46(92) | 1(2) | 3(6) | 7(14) | 43(96) | 47(94) | 3(6) | 43(86) | 4(8) | 3(6) | 47(94) | 3(6) | |||
| Total(50) | 46(92) | 1(2) | 3(6) | 7(14) | 43(96) | 47(94) | 3(6) | 43(86) | 4(8) | 3(6) | 47(94) | 3(6) | |||
| A. Baumannii(14 ) | |||||||||||||||
| A. Baylyi(1) | |||||||||||||||
| A. bereziniae (2) | 1(50) | 1(50) | |||||||||||||
| A. Calcoaceticus(1) | |||||||||||||||
| A. dijkshoorniae (2) | 1(50) | 1(50) | |||||||||||||
| A. pittii(5) | 1(20) | ||||||||||||||
| A. schindleri (1) | |||||||||||||||
| A.tandoi(1) | |||||||||||||||
| Total(27) | 1(3.7) | 1(3.7) | 2(7.4) | 1(3.7) | |||||||||||
R: Resistant, I: Intermediate sensitive, S: Sensitive, SXT: Trimethoprim-Sulfamethoxazole, CIP: Ciprofloxacin; TZP: Piperacillin-Tazobactam, TE: Tetracycline, AK: Amikacin, MEM: Meropenem, CL: Colistin, CAZ: Ceftazidime, CN: Gentamycin, IPM, Imipenem
Antibiotic susceptibilities and efflux pump genes among the Acinetobacter spp. and their sources are presented in Table 2 and Fig. 1. PCR products of adeABC, adeR, and adeS genes are shown in Fig. 2. The correlations between efflux pump genes and antibiotic resistance patterns of the strains is presented in Tables 3 and 4. PFGE analyses; there were no clonal relations between foodborne and clinical strains. Both groups have separate related or unique clusters (Data not shown).
Fig. 1:
Distribution of oxa-51, adeABC, adeR, and adeS efflux pump genes of Acinetobacter spp. from foodborne and clinical samples
Fig. 2:
PCR results of oxa-51, adeABC, adeR, adeS efflux pump genes. (A): (Oxa-51); M: Marker (100bp), 1: negative control, 2: A. pittii (cheese): (B): (adeA); 1: A. baumannii (veal), M: Marker, (C): (adeS, adeB, adeC); M: Marker (100bp), 1: A. pittii (cheese). (D): (adeR); 1: A. bauannii (lettuce), M: Marker (50bp), 2: A. baumannii (veal), 3: A. baumannii (sucuk)
Table 3:
The correlation between antibiotic resistance and adeABC and adeR, adeS genes of clinical A. baumannii strains (n=50)
| Antibiotics | Eflux Pump Genes | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| adeA | P | adeB | P | adeC | P | adeS | P | adeR | P | |||||||
| n=7/0 | n=43/1 | n=2/0 | n=48/1 | n=0 | n=50/1 | n=16/0 | n=34/1 | n=2/0 | n=48/1 | |||||||
| No.(%) | No.(%) | No.(%) | No.(%) | No.(%) | ||||||||||||
| TZP | R | 5(71.4) | 42(97.7) | 0.048 | 1(50) | 46(95.8) | 0.118 | 47(94) | 0 | N | 14(87.5) | 33(97.1) | 0.237 | 1(50) | 46(95.8) | 0.118 |
| S | 2(28.6) | 1(2.3) | 1(50) | 2(4.2) | 3(6) | 0 | 2(12.5) | 1(2.9) | 1(50) | 2(4.2) | ||||||
| CAZ | R | 5(71.4) | 42(97.7) | 0.048 | 1(50) | 46(95.8) | 0.118 | 47(94) | 0 | N | 14(87.5) | 33(97.1) | 0.237 | 1(50) | 46(95.8) | 0.118 |
| S | 2(28.6) | 1(2.3) | 1(50) | 2(4.2) | 3(6) | 0 | 2(12.5) | 1(2.9) | 1(50) | 2(4.2) | ||||||
| CIP | R | 5(71.4) | 40(93) | 0.138 | 1(50) | 44(91.7) | 0.192 | 45(90) | 0 | N | 13(81.3) | 32(94.1) | 0.311 | 1(50) | 44(91.7) | 0.192 |
| S | 2(28.6) | 3(7) | 1(50) | 4(8.3) | 5(10) | 0 | 3(18.8) | 2(5.9) | 1(50) | 4(8.3) | ||||||
| SXT | R | 4(57.1) | 40(93) | 0.029 | 1(50) | 43(89.6) | 0.228 | 44(88) | 0 | N | 12(75) | 32(94.1) | 0.074 | 1(50) | 43(89.6) | 0.228 |
| S | 3(42.9) | 3(7) | 1(50) | 5(10.4) | 6(12) | 0 | 4(25) | 2(5.9) | 1(50) | 5(10.4) | ||||||
| GN | R | 4(57.1) | 39(90.7) | 0.048 | 1(50) | 42(87.5) | 0.263 | 43(86) | 0 | N | 13(81.3) | 30(88.2) | 0.666 | 1(50) | 42(87.5) | 0.263 |
| S | 3(42.9) | 4(9.3) | 1(50) | 6(12.5) | 7(14) | 0 | 3(18.8) | 4(11.8) | 1(50) | 6(12.5) | ||||||
| MEM | R | 5(71.4) | 41(95.3) | 0.089 | 1(50) | 45(93.8) | 0.155 | 46(92) | 0 | N | 13(81.3) | 33(97.1) | 0.091 | 1(50) | 45(93.8) | 0.155 |
| S | 2(28.6) | 2(4.7) | 1(50) | 3(6.2) | 4(8) | 0 | 3(18.8) | 1(2.9) | 1(50) | 3(6.3) | ||||||
| AK | R | 4(57.1) | 42(97.7) | 0.007 | 1(50) | 45(93.8) | 0.155 | 46(92) | 0 | N | 13(81.3) | 33(97.1) | 0.091 | 1(50) | 45(93.8) | 0.155 |
| S | 3(42.9) | 1(2.3) | 1(50) | 3(6.2) | 4(8) | 0 | 3(18.8) | 1(2.9) | 1(50) | 3(6.3) | ||||||
| IMP | R | 5(71.4) | 42(97.7) | 0.048 | 1(50) | 46(95.8) | 0.118 | 47(94) | 0 | N | 14(87.5) | 33(97.1) | 0.237 | 1(50) | 46(95.8) | 0.118 |
| S | 2(28.6) | 1(2.3) | 1(50) | 2(4.2) | 3(6) | 0 | 2(12.5) | 1(2.9) | 1(50) | 2(4.2) | ||||||
| COL | R | 0 | 7(16.3) | 0.573 | 0 | 7(14.6) | 1000 | 7(14) | 0 | N | 0 | 7(20.6) | 0.081 | 0 | 7(14.6) | 1000 |
| S | 7(100) | 36(83.7) | 2(100) | 41(85.4) | 43(86) | 0 | 16(100) | 27(79.4) | 2(100) | 41(85.4) | ||||||
S: Sensitive and intermediate sensitive, R: Resistant, N: Not applicable, 0: The gene absent, 1: The gene present, bold P-values indicate statistically significant correlation. SXT; Trimethoprim-Sulfamethoxazole, CIP; Ciprofloxacin, TZP; Piperacillin-Tazobactam, TE; Tetracycline, AK; Amikacin, MEM; Meropenem, CL; Colistin, CAZ; Ceftazidime, CN; Gentamycin, IPM; Imipenem
Table 4:
The correlation between antibiotic resistance and adeABC, and adeR, adeS genes of foodborne Acinetobacter spp. (n=27)
| Eflux Pump Genes | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Antibiotics | adeA | P | adeB | P | adeC | P | adeS | P | adeR | P | ||||||
| n=4/0 | n=23/1 | n=18/0 | n=9/1 | n=0 | n=27/1 | n=17/0 | n=10/1 | n=9/0 | n=18/1 | |||||||
| No.(%) | No.(%) | No.(%) | No.(%) | No.(%) | ||||||||||||
| TZP | R | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N |
| S | 4(100) | 23(100) | 18(100) | 9(100) | 0 | 27(100) | 17(100) | 10(100) | 9(100) | 18(100) | ||||||
| CAZ | R | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N |
| S | 4(100) | 23(100) | 18(100) | 9(100) | 0 | 27(100) | 17(100) | 10(100) | 9(100) | 18(100) | ||||||
| CIP | R | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N |
| S | 4(100) | 23(100) | 18(100) | 9(100) | 0 | 27(100) | 17(100) | 10(100) | 9(100) | 18(100) | ||||||
| SXT | R | 1(25) | 3(13) | 0.629 | 2(11.1) | 2(22.2) | 0.056 | 0 | 4(14.8) | N | 1(5.9) | 3(30) | 0.018 | 1(11.1) | 3(16.7) | 0.375 |
| S | 3(75) | 20(87) | 16(88.9) | 7(77.8) | 0 | 22(85.2) | 16(94.1) | 7(70) | 8(88.9) | 15(85) | ||||||
| GN | R | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N |
| S | 4(100) | 23(100) | 18(100) | 9(100) | 0 | 27(100) | 17(100) | 10(100) | 9(100) | 18(100) | ||||||
| MEM | R | 1(25) | 0 | 0.116 | 1(5.6) | 0 | 1000 | 0 | 1(3.7) | N | 1(5.9) | 0 | 1000 | 1(11.1) | 0 | 0.333 |
| S | 3(75) | 23(100) | 17(94.4) | 9(100) | 0 | 26(96.3) | 16(94.1) | 10(100) | 8(88.9) | 18(100) | ||||||
| AK | R | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N |
| S | 4(100) | 23(100) | 18(100) | 9(100) | 0 | 27(100) | 17(100) | 10(100) | 9(100) | 18(100) | ||||||
| IMP | R | 1(25) | 0 | 0.148 | 1(5.6) | 0 | 1000 | 0 | 1(3.7) | N | 1(5.9) | 0 | 1000 | 1(11.1) | 0 | 0.333 |
| S | 3(75) | 23(100) | 17(94.4) | 9(100) | 0 | 26(96.3) | 16(94.1) | 10(100) | 8(88.9) | 18(100) | ||||||
| COL | R | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N | 0 | 0 | N |
| S | 4(100) | 23(100) | 18(100) | 9(100) | 0 | 27(100) | 17(100) | 10(100) | 9(100) | 18(100) | ||||||
S: Sensitive and intermediate sensitive, R: Resistant, N: Not applicable, 0: The gene absent, 1: the gene present, bold P-values indicate statistically significant correlation. SXT; Trimethoprim-Sulfamethoxazole, CIP; Ciprofloxacin, TZP; Piperacillin-Tazobactam, TE; Tetracycline, AK; Amikacin, MEM; Meropenem, CL; Colistin, CAZ; Ceftazidime, CN; Gentamycin, IPM; Imipenem
Discussion
Acinetobacter spp. can be found in various foods but, the multidrug-resistant A. baumannii (MDRAB) is a crucial problem in the medical field because it is difficult to treat and causes fatal results (16,17). Most of our foodborne and clinical strains was A. baumanni (14, 51.9%; 50, 100%); A. pitti (5) and A. calcoaceticus (1) were also considered A. baumannii group that is most frequently associated with nosocomial infections worldwide (6,18). In our foodborne isolates, this group’s rate was at a frequency of 74.07% (20/27). Furthermore, 7 (25.9%) of foodborne strains were found to be resistant to trimethoprim-sulfamethoxazole, tetracycline, meropenem and imipenem, and A. dijkshoorniae strain was found MDR (Table 2). Our results (3.7%; 1/27, MDR) were lower than previous studies (6,19). They found about 29.8% of the strains were (MDR) and 4.4% as (XDR) of Acinetobacter spp. in fruit and vegetable samples in Portugal, and 50% (MDR) in chicken meat samples in Iran. Our clinical A. baumanni strains were nearly fully resistant (95%) to the antibiotics tested and (92%; 8%) of them XDR and MDR respectively. These results were lower than previous results for countries; Iran (100%), China (100%), and Pakistan (16,20–22). Additionally, seven (14%) clinical strains were found resistant to colistin, and their MIC value was ≥4 μg/mL, and these strains were resistant to all tested antibiotics. Our result is higher than the resistance rate (2.9%) reported from Iran (22), and unlike previous studies in Pakistan and Saudi Arabia, no colistin-resistant A. baumannii isolates were found in their studies (16,21).
The multidrug efflux pump for the trans membrane protein of adeABC is encoded by the adeB gene. Nearly all clinical A. baumannii isolates (96%), and 33% of foodborne Acinetobacter spp. in the present study were found to carry the adeB gene. This rate was 100% in Iran (23). The disruption of this gene leads to the loss of multidrug resistance previously reported (24). Our study showed a high incidence of adeA, adeB, and adeC, genes (86%, 96%, and 100%) respectively among clinical isolates (Fig. 1). Similar results were reported (88.5%, 100%, and 93.9%, respectively) in Iran (23). There was a significant difference in the occurrence of multi-efflux pump genes between human clinical and foodborne isolates (P<0.001). Multidrug efflux pumps can play a crucial role in the mechanism of resistance in our clinical strains in agreement with a recent report conducted in Iran (23).
Antibiotic resistance and adeR and adeS genes incidence of clinical A. baumannii strains have shown some differences from country to country. The distribution of adeS, and adeR genes among our A. baumannii strains was 68%, and 96%, respectively. Our adeS gene rate was lower but adeR gene prevalence was higher than the previous studies in Iran and China (25,26).
Antibiotic-sensitive Acinetobacter spp. could be carry adeA, adeB, adeC and adeR, adeS genes, but some of them implied that only resistant strains carried those genes (11). However, we detected a higher incidence of these genes, (%85.2; 33.3%; 100 and 37.3%; 66.7% respectively) in our food-borne strains, while being sensitive to most of the tested antibiotics.
In foodborne Acinetobacter spp., a positive correlation was found between adeS gene positivity and trimethoprim-sulfamethoxazole resistance (P=0.018). adeS gene may have an effective role in acquiring trimethoprim-sulfamethoxazole (folate pathway inhibitors) resistance in foodborne Acinetobacter spp. (Table 4). There was a significant interdependence between harboring of adeA gene positivity and amikacin, piperacillintazobactam, ceftazidime, gentamycin, imipenem, and trimethoprim-sulfamethoxazole resistance that were found respectively in clinical Acinetobacter spp. (Table 3). The presence of adeABC genes can stimulate the resistance to piperacillintazobactam, ceftazidime, gentamycin, imipenem, and trimethoprim-sulfamethoxazole resistance, and drug efflux pumps contribute to the resistance to β-lactam/β-lactamase, cephems, aminoglycosides, carbapenems, and folate pathway inhibitors, respectively in clinical strains. Our results show some similarities to previous reports (27) about adeA and adeS genes are related to the tetracycline, ciprofloxacin, gentamicin, and amikacin resistance and another findings of stimulation of carbapenem resistance (11). Our findings digress from previous reports claiming that the adeC gene is not essential for (AB-MDR) phenotypes. We have detected adeC (100%) gene in all strains (sensitive and resistant) (Fig. 1). Besides, our results are in line with some previous studies which revealed the adeABC efflux pump was present in both carbapenem-resistant and sensitive strains (28,29).
Conclusion
High rates of efflux pump genes in many antibiotic-susceptible food isolates suggests that these genes may have been transferred by other pathogens in the food processing line. The positive correlation between the adeS gene positivity and trimethoprim-sulfamethoxazole resistance in them is a crucial finding. Moreover, the positive correlation between the phenotypic resistance to various antibiotics of clinical A. baumannii strains carrying the adeA gene be taken into consideration in terms of the effect of the adeA gene on the development of carbapenems and other antibiotics’ phenotypic resistance. No genetic relations were found between the two groups, which meant that foodborne Acinetobacter spp. was not a reason for A. baumanni infections. However, more foodborne and clinical strains should be studied in this regard in a wider area for more information.
Journalism Ethical considerations
Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
Acknowledgements
This study was supported by the Osmaniye Korkut Ata University Scientific Research Project Unit (project number: OKUBAP-2020-PT 2-001).
Footnotes
Conflict of interest
The authors declare that there is no conflict of interests.
References
- 1.Møretrø T, Langsrud S. (2017). Residential bacteria on surfaces in the food industry and their implications for food safety and quality. Compr Rev Food Sci Food Saf, 16(5):1022–1041. [DOI] [PubMed] [Google Scholar]
- 2.Kyriakidis I, Vasileiou E, Pana ZD, et al. (2021). Acinetobacter baumannii Antibiotic Resistance Mechanisms. Pathogens, 10(3): 373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Imperi F, Antunes LC, Blom J, et al. (2011). The genomics of Acinetobacter baumannii: insights into genome plasticity, antimicrobial resistance and pathogenicity. IUBMB Life, 63(12):1068–74. [DOI] [PubMed] [Google Scholar]
- 4.Metzgar D, Bacher JM, Pezo V, et al. (2004). Acinetobacter sp. ADP1: an ideal model organism for genetic analysis and genome engineering. Nucleic Acids Res, 32(19):5780–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Lupo A, Vogt D, Seiffert SN, et al. (2014). Antibiotic resistance and phylogenetic characterization of Acinetobacter baumannii strains isolated from commercial raw meat in Switzerland. J Food Prot, 77:1976–1981. [DOI] [PubMed] [Google Scholar]
- 6.Carvalheira A, Silva J, Teixeira P. (2017). Lettuce and fruits as a source of multidrug resistant Acinetobacter spp. Food Microbiol, 64:119–125. [DOI] [PubMed] [Google Scholar]
- 7.Kanaan MHG, Al-Shadeedi SM, Al-Massody A J, et al. (2020). Drug resistance and virulence traits of Acinetobacter baumannii from Turkey and chicken raw meat. Comp Immunol Microbiol Infect Dis, 70: 101451. [DOI] [PubMed] [Google Scholar]
- 8.Espinal P, Seifert H, Dijkshoorn L, et al. (2012). Rapid and accurate identification of genomic species from the Acinetobacter baumannii (Ab) group by MALDI-TOF MS. Clin Microbiol Infect, 18:1097–1103. [DOI] [PubMed] [Google Scholar]
- 9.Franco MR, Caiaffa-Filho HH, Burattini MN, et al. (2010). Metallo-beta-lactamases among imipenem resistant Pseudomonas aeruginosa in a Brazilian university hospital. Clinics (Sao Paulo), 2010: 65: 825–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Voets GM, Fluit AC, Scharringa J, et al. (2011). A set of multiplex pcrs for genotypic detection of extended-spectrum β628 lactamases, carbapenemases, plasmid-mediated ampc β-lactamases and oxa β629 lactamases. Int J Antimicrob Agents, 37(4): 356–9. [DOI] [PubMed] [Google Scholar]
- 11.Ranjbar R, Zayeri S, Afshar D. (2020). High frequency of adeA, adeB and adeC genes among Acinetobacter baumannii isolates. Iran J Public Health, 49(8):1539–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.CLSI M100-ED31, (2021). Performance Standards for Antimicrobial Susceptibility Testing, 31st ed.; CLSI: Annapolis Junction, MD, USA, 2021. Available online: https://clsi.org/standards/products/microbiology/documents/m100/ (accessed on 25 June 2021). [Google Scholar]
- 13.Espinal P, Poirel L, Carmeli Y, et al. (2013). Spread of NDM-2-producing Acinetobacter baumannii in the Middle East. J Antimicrob Chemother, 68(8):1928–1930. [DOI] [PubMed] [Google Scholar]
- 14.EUCAST, (2017). The European Committee on Antimicrobial Susceptibility Testing. Ref: Breakpoint tables for interpretation of MICs and zone diameters. Version 7.1, 2017. http://www.eucast.org (11/12/2017).
- 15.Durmaz R, Otlu B, Koksal F, et al. (2009). The optimization of a rapid pulsed-field gel electrophoresis 271 protocol for the typing of Acinetobacter baumannii, Escherichia coli and Klebsiella 272 spp. Jpn J Infect Dis, 62:372–377. [PubMed] [Google Scholar]
- 16.Gholami M, Haghshenas M, Moshiri M, et al. (2017). Frequency of 16S rRNA Methylase and Aminoglycoside-Modifying Enzyme Genes among Clinical Isolates of Acinetobacter baumannii in Iran. Iran J Pathol, 12(4):329–38. [PMC free article] [PubMed] [Google Scholar]
- 17.Li S, Duan X, Peng Y, et al. (2019). Molecular characteristics of carbapenem-resistant Acinetobacter spp. from clinical infection samples and fecal survey samples in Southern China. BMC Infect Dis, 19(1):900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Park YK, Choi JY, Shin D, et al. (2011). Correlation between overexpression and amino acid substitution of the PmrAB locus and colistin resistance in Acinetobacter baumannii. Int J Antimicrob Agents, 37(6):525–530. [DOI] [PubMed] [Google Scholar]
- 19.Askari N, Momtaz H, Tajbakhsh E. (2019). Acinetobacter baumannii in sheep, goat, and camel raw meat: virulence and antibiotic resistance pattern. AIMS Microbiol, 5(3):272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Xiao-min X, You-fen F, Wei-yun F, et al. (2014). Antibiotic resistance determinants of a group of multidrug-resistant Acinetobacter baumannii in China. J Antibiot (Tokyo), 67(6):439–44. [DOI] [PubMed] [Google Scholar]
- 21.Shamim S, Abbas M, Qazi MH. (2015). Prevalence of Multidrug Resistant Acinetobacter baumannii in Hospitalized Patients in Lahore, Pakistan. Pak J Mol Med, 2(1):23–8. [Google Scholar]
- 22.Khoshnood S, Savari M, Montazeri E A, et al. (2020). Survey on genetic diversity, biofilm formation, and detection of colistin resistance genes in clinical isolates of Acinetobacter baumannii. Infect Drug Resist, 13:1547–1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Angoti G, Bandehpour M, Goudarzi H, et al. (2016). Detection of efflux pump genes (adeA, adeB, adeC and abeM) in Acinetobacter baumannii isolated from hospitalize patients, North-west of Iran. Infect Epidemiol Microbiol, 2(4):8–11. [Google Scholar]
- 24.Magnet S, Courvalin P, Lambert T. (2001). Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob Agents Chemother, 45(12):3375–3380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ostad Asadolah-Malayeri H, Hakemi-Vala M, Davari K. (2016). Role of Aders and OXA23 genes among imipenem resistant Acinetobacter baumannii isolates from two hospitals of Tehran, Iran. Iran J Pathol, 11(4): 345–353. [PMC free article] [PubMed] [Google Scholar]
- 26.Hou PF, Chen XY, Yan GF, Wang YP, Ying CM. (2012). Study of the correlation of imipenem resistance with efflux pumps Ade-ABC, AdeIJK, AdeDE and AbeM in clinical isolates of Acinetobacter baumannii. Chemotherapy, 58(2): 152–158. [DOI] [PubMed] [Google Scholar]
- 27.Basatian-Tashkan B, Niakan M, Khaledi M, et al. (2020). Antibiotic resistance assessment of Acinetobacter baumannii isolates from Tehran hospitals due to the presence of efflux pumps encoding genes (adeA and adeS genes) by molecular method. BMC Res Notes, 13(1):1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Bratu S, Landman D, Martin DA, et al. (2008). Correlation of antimicrobial resistance with beta-lactamases, the OmpA-like porin, and efflux pumps in clinical isolates of Acinetobacter baumannii endemic to New York City. Antimicrob Agents Chemother, 52(9):2999–3005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Huang J, Huang J, Yu F, et al. (2010). AdeABC efflux pump: Less important role in Acinetobacter baumannii against carbapenems. Afr J Microbiol Res, 4(20):2148–2152. [Google Scholar]