Key resources Table
| Reagent or Resource | Source | Identifier |
|---|---|---|
| Antibodies | ||
| CD116/32 - unconjugated (clone: 2.4g2) | University of Chicago Cytometry and Antibody Technology Facility | |
| CD3 - Biotin (clone: 17A2) | Biolegend | Cat# 100244 |
| CD3 - FITC (clone: 17A2) | Biolegend | Cat# 100204 |
| CD4 - Biotin (clone: GK1.5) | Biolegend | Cat# 100404 |
| CD4 - PE/Cy7 (clone: GK1.5) | Biolegend | Cat# 100422 |
| CD4 - APC (clone: GK1.5) | Biolegend | Cat# 100412 |
| CD8a - Biotin (clone: 53-6.7) | Biolegend | Cat# 100704 |
| CD8a - Pacific Blue (clone: 53-6.7) | Biolegend | Cat# 100725 |
| CD8a - BV605 (clone: 53-6.7) | Biolegend | Cat# 100744 |
| CD8a - FITC (clone: 53-6.7) | Biolegend | Cat# 100706 |
| CD8a - PerCP/Cy5.5 (clone: 53-6.7) | Biolegend | Cat# 100734 |
| CD8a - PE (clone: 53-6.7) | Biolegend | Cat# 100708 |
| CD8a - PE/Cy7 (clone: 53-6.7) | Biolegend | Cat# 100722 |
| CD8a - APC (clone: 53-6.7) | Biolegend | Cat# 100712 |
| CD8a - APC/Cy7 (clone: 53-6.7) | Biolegend | Cat# 100714 |
| CD8b - FITC (clone: YTS156.7.7) | Biolegend | Cat# 126606 |
| CD11b - Biotin (clone: M1/70) | Biolegend | Cat# 101204 |
| CD11b - BV510 (clone: M1/70) | Biolegend | Cat# 101263 |
| CD11b - PerCP/Cy5.5 (clone: M1/70) | Biolegend | Cat# 101228 |
| CD11c - Biotin (clone: N418) | Biolegend | Cat# 117304 |
| CD11c - PE/Cy7 (clone: N418) | Biolegend | Cat# 117318 |
| CD11c - APC (clone: N418) | Biolegend | Cat# 117310 |
| CD19 - Biotin (clone: 6D5) | Biolegend | Cat# 115504 |
| CD24 - FITC (clone: M1/69) | Biolegend | Cat# 101806 |
| CD44 - Pacific Blue (clone: IM7) | Biolegend | Cat# 103020 |
| CD44 - PE/Cy7 (clone: IM7) | Biolegend | Cat# 103030 |
| CD45.1 - Pacific Blue (clone: A20) | Biolegend | Cat# 110722 |
| CD45.1 - FITC (clone: A20) | Biolegend | Cat# 110706 |
| CD45.1 - PE (clone: A20) | Biolegend | Cat# 110708 |
| CD45.1 - APC (clone: A20) | Biolegend | Cat# 110714 |
| CD45.2 - Pacific Blue (clone: 104) | Biolegend | Cat# 109820 |
| CD45.2 - FITC (clone: 104) | Biolegend | Cat# 109806 |
| CD45.2 - PE/Cy7 (clone: 104) | Biolegend | Cat# 109830 |
| CD45.2 - APC (clone: 104) | Biolegend | Cat# 109814 |
| CD64 - FITC (clone: X54-5/7.1) | Biolegend | Cat# 139316 |
| CD64 - PE/Cy7 (clone: X54-5/7.1) | Biolegend | Cat# 139314 |
| CD80 - FITC (clone: 16-10A1) | Biolegend | Cat# 104706 |
| CD80 - PE (clone: 16-10A1) | Biolegend | Cat# 104708 |
| CD86 - BV605 (clone: GL-1) | Biolegend | Cat# 105037 |
| CD86 - FITC (clone: GL-1) | Biolegend | Cat# 105006 |
| CD86 - PE (clone: GL-1) | Biolegend | Cat# 105008 |
| CD90.1 - Pacific Blue (clone: OX-7) | Biolegend | Cat# 202522 |
| CD90.1 - FITC (clone: OX-7) | Biolegend | Cat# 202504 |
| CD90.2 - FITC (clone: 30-H12) | Biolegend | Cat# 105306 |
| CD90.2 - APC (clone: 30-H12) | Biolegend | Cat# 105312 |
| CD90.2 - PE/Cy7 (clone: 30-H12) | Biolegend | Cat# 105314 |
| CD103 - BV421 (clone: 2E7) | Biolegend | Cat# 121422 |
| CD103 - FITC (clone: 2E7) | Biolegend | Cat# 121420 |
| CD103 - PE (clone: 2E7) | Biolegend | Cat# 121406 |
| B220 - Biotin (clone: RA3-6B2) | Biolegend | Cat# 103204 |
| B220 - FITC (clone: RA3-6B2) | Biolegend | Cat# 103206 |
| F4/80 - BV421 (clone: BM8) | Biolegend | Cat# 123137 |
| F4/80 - PE/Cy7 (clone: BM8) | Biolegend | Cat# 123112 |
| Gr-1 - Biotin (clone: RB6-8C5) | Biolegend | Cat# 108404 |
| Granzyme B - PerCP/Cy5.5 (clone: QA16A02) | Biolegend | Cat# 372211 |
| H-2Kb - PE (clone: AF6-88.5) | eBioscience | Cat# 12-5958-82 |
| H-2Kb - APC (clone: AF6-88.5) | Biolegend | Cat# 116518 |
| H-2Kb:SIINFEKL - APC (clone: 25-D1.16) | Biolegend | Cat# 141606 |
| I-A/I-E - Biotin (clone: M5/114.15.2) | Biolegend | Cat# 107604 |
| I-A/I-E - Pacific Blue (clone: M5/114.15.2) | Biolegend | Cat# 107619 |
| I-A/I-E - FITC (clone: M5/114.15.2) | Biolegend | Cat# 107606 |
| I-A/I-E - PerCP/Cy5.5 (clone: M5/114.15.2) | Biolegend | Cat# 107626 |
| IFN-γ - APC (clone: XMG1.2) | BD Pharmingen | Cat# 554413 |
| NK1.1 - Biotin (clone: PK136) | Biolegend | Cat# 108704 |
| SIRP-a - PE (clone: P84) | Biolegend | Cat# 144012 |
| TCRb - Biotin (clone: H57-597) | Biolegend | Cat# 109204 |
| TCRb - FITC (clone: H57-597) | Biolegend | Cat# 109205 |
| TCRb - PerCP/Cy5.5 (clone: H57-597) | Biolegend | Cat# 109228 |
| TCR Va2 - PE (clone: B20.1) | Biolegend | Cat# 127808 |
| TCR Va2 - APC (clone: B20.1) | Biolegend | Cat# 127810 |
| TNF-α - PE (clone: MP6-XT22) | Invitrogen | Cat# 12-7321-82 |
| 2C TCR - Biotin (clone: 1B2) | University of Chicago Cytometry and Antibody Technology Facility | |
| hCD14 - PerCP/Cy5.5 (clone: 63D3) | Biolegend | Cat# 367110 |
| hCD19 - APC (clone: HIB19) | Biolegend | Cat# 302212 |
| hCD19 - FITC (clone: HIB19) | Biolegend | Cat# 302206 |
| hCD20 - PerCP/Cy5.5 (clone: 2H7) | Biolegend | Cat# 302326 |
| HLA-A/B/C - PE (clone: W6/32) | Biolegend | Cat# 311406 |
| HLA-A*02 - PE (clone: BB7.2) | Abcam | Cat# ab79523 |
| Anti-CD47 – unconjugated (clone: B6.H12) | Bio X Cell | Cat# BE0019-1 |
| Mouse IgG1 Isotype control – unconjugated (clone MOPC-21) | Bio X Cell | Cat# BE0083 |
| Chemicals, peptides, and recombinant proteins | ||
| Kb:SIY pentamer – PE | ProImmune | Cat# 1803 |
| Kb: SIINFEKL pentamer - PE | Proimmune | Cat# 93 |
| LIVE/DEAD Fixable Near-IR Dead Cell Stain Kit | Invitrogen | Cat# L10119 |
| Pacific Orange succinimidyl ester | Invitrogen | Cat# P30254 |
| Golgi Plug | BD | Cat# 555029 |
| CellTrace Violet Cell Proliferation Kit | Invitrogen | Cat# C34557 |
| FOXP3/Transcription Factor Staining Buffer Set | Invitrogen | Cat# 00-5523-00 |
| Recombinant mouse Flt3L (carrier-free) | Biolegend | Cat# 550706 |
| Recombinant human M-CSF | Peprotech | Cat# 216-MC-025/CF |
| Dnase I | Roche | Cat# 10104159001 |
| Collgenase IV | Sigma | Cat# C5138 |
| 2X Taq RED Master Mix | Apex | Cat# 42-138B |
| High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | Cat# 4368814 |
| Phusion High-Fidelity DNA Polymerase | New England Biolabs | Cat# M0530S |
| Critical commercial assays | ||
| Venor GeM Mycoplasma Detection Kit, PCR-based | Sigma | Cat# MP0025-1KT |
| QIAquick Gel Extraction Kit | QIAGEN | Cat# 28704 |
| Experimental models: cell lines | ||
| C1498 | ATCC | |
| B16.OVA | Schumacher Lab, Netherlands Cancer Institute | |
| OCI-Ly1 | ATCC | |
| OCI-Ly8 | ATCC | |
| Experimental models: organisms/strains | ||
| Mouse: C57BL/6 | Jackson Laboratories, Bar Harbor, Maine | Strain # 000664 |
| Mouse: Ly5.1: B6.SJL-Ptprca Pepcb/BoyJ | Jackson Laboratories, Bar Harbor, Maine | Strain # 000664 |
| Mouse: Thy1.1: B6.PL-Thy1a/CyJ | Gajewski Lab, University of Chicago | JAX strain # 000406 |
| Mouse: Tap1−/−: B6.129S2-Tap1tm1Arp/J | Jackson Laboratories, Bar Harbor, Maine | Strain # 002944 |
| Mouse: Kb−/−Db−/−: B6.129P2-H2-K1tm1Bpe H2-D1tm1Bpe/DcrJ | Bendelac Lab, University of Chicago | JAX strain # 019995 |
| Mouse: Wdfy4−/− | This paper | |
| Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/J | Gajewski Lab, University of Chicago | JAX strain # 003831 |
| Mouse: 2C: B6-Tg(Tcra2C,Tcrb2C)1Dlo | Gajewski Lab, University of Chicago | |
| Mouse: NSG: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ | Jackson Laboratories, Bar Harbor, Maine | Strain # 005557 |
| Oligonucleotides | ||
| Alt-R CRISPR-Cas9 crRNA Wdfy4 5’ Sense gRNA1 – CATGTAGCCTTGAGGTACAT | IDT | |
| Alt-R CRISPR-Cas9 crRNA Wdfy4 5’ Antisense gRNA1 – CTCCAGGGCTATTAACCTGG | IDT | |
| Alt-R CRISPR-Cas9 crRNA Wdfy4 3’ Sense gRNA2 – CAGGCCTCGAAGGTGTTCCC | IDT | |
| Alt-R CRISPR-Cas9 crRNA Wdfy4 3’ Antisense gRNA2 - GTCCCCTTTCCTCATAGACT | IDT | |
| Wdfy4 genotyping fwd primer – GCCTTGAGGTACATGGGCAA | IDT | |
| Wdfy4 genotyping rev primer – GGTTACACACAGCTCGTCCAT | IDT | |
| Wdfy4 transcript ex1 fwd primer – CTGGTGTAGCTTGTGAAGGGT | IDT | |
| Wdfy4 transcript ex2 fwd primer – TTCACTAGAAGGGCAGTCGC | IDT | |
| Wdfy4 transcript ex6 rev primer – CCTCCAGACCCTGAGATTCG | IDT | |
| Wdfy4 transcript ex7 rev primer – CCCCGTTCTCAAACTCCAGG | IDT | |
| Recombinant DNA | ||
| Kb-eGFP | Springer Lab (Hein et al., 2014) | |
| Software and algorithms | ||
| FlowJo v. 10 | BD | |
| IDEAS | Amnis | |
| ImmunoSpot | Cellular Technology Limited | |
| Prism v. 7 | GraphPad | |
| R v. 3.6.3 | R Foundation for Statistical Computing | |
| Rstudio v. 1.2.1335 | Rstudio, Inc | |
| Illustrator | Adobe |