Skip to main content
. Author manuscript; available in PMC: 2024 Feb 2.
Published in final edited form as: Structure. 2022 Dec 15:S0969-2126(22)00488-9. doi: 10.1016/j.str.2022.12.002

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit monoclonal anti-HsClpP Abcam RRID:AB_124822
Rabbit monoclonal anti-HsClpX Abcam RRID:AB_168338
Rabbit monoclonal anti-Mcl1 Cell Signaling Technology RRID:AB_2799149
Rabbit monoclonal anti-Caspase 8 Cell Signaling Technology RRID:AB_10545768
Rabbit monoclonal anti-Caspase 9 Cell Signaling Technology RRID:AB_2068621
Rabbit polyclonal anti-TFAM Proteintech RRID:AB_11182588
Rabbit polyclonal anti-Grp75 Proteintech RRID:AB_2120458
Goat monoclonal anti-Caspase 3 R&D Biosystems RRID:AB_354518
Mouse monoclonal anti-GAPDH Abcam RRID:AB_8245
HRP-conjugated goat anti-rabbit IgG BioRad RRID:AB_11125142
HRP-conjugated goat anti-mouse IgG BioRad RRID:AB_11125547
HRP-conjugated rabbit anti-goat IgG Sigma-Aldrich RRID:AB_258242
Chemicals, Peptides, and Recombinant Proteins
Sodium acetate, ACS Reagent, ≥ 99.0% Sigma-Aldrich Cat#241245
PEG 4,000, powder Sigma-Aldrich Cat#8.17006
TR-27 reference19 N/A
TR-57 reference19 N/A
TR-65 reference19 N/A
TR-107 This paper N/A
TR-133 This paper N/A
ADEP-14 reference6 N/A
Doxorubicin (hydrochloride) Cayman Chemical Co. Cat#15007
Sulforhodamine B (SRB) Sigma-Aldrich Cat#230162
jetPRIME Transfection Reagent Polyplus Transfection Cat#114–07
jetPRIME Transfection Buffer Polyplus Transfection Cat#712–60
Reprosil-Pur 120 C18-AQ, 1.9 μm Dr. Maisch Cat#r119.aq.
Casein-FITC Sigma-Aldrich Cat# C3777
Untagged human mitochondrial ClpP This paper N/A
Yeast SUMO protease reference52 N/A
Critical Commercial Assays
PureLink Quick Plasmid Miniprep Kit Thermo-Fisher Scientific Cat#K210011
Pierce BCA Protein Assay Kit Thermo-Fisher Scientific Cat#23225
Deposited Data
Structure of human ClpP complex with ADEP-28 Protein Data Bank reference6 6BBA
Structure of human ClpP complex with ONC201 Protein Data Bank reference8 6DL7
Structure of human ClpP complex with ZG111 Protein Data Bank reference34 7VP9
Structure of human ClpP Y118A mutant complex with D9 Protein Data Bank reference7 6H23
Structure of human ClpP complex with TR-27 Protein Data Bank (This paper) 7UVM
Structure of human ClpP complex with TR-57 Protein Data Bank (This paper) 7UVN
Structure of human ClpP complex with TR-65 Protein Data Bank (This paper) 7UVR
Structure of human ClpP complex with TR-107 Protein Data Bank (This paper) 7UVU
Structure of human ClpP complex with TR-133 Protein Data Bank (This paper) 7UW0
HYTANE data MassIVE repository (This paper) MSV000089642
Experimental Models: Cell Lines
HEK293 T-REx Gift from A. Trifunovic RRID:CVCL_U427
HEK293 T-RExCLPP−/− reference53 N/A
HEK293 T-RExCLPX−/− reference6 N/A
MDA-MB-231 Gift from L. Attisano RRID:CVCL_0062
MDA-MB-231 CLPP−/− This paper N/A
MDA-MB-231 CLPX−/− This paper N/A
Experimental Models: Organisms / Strains
Escherichia coli DH5α Lab stock NCBI:txid668369
Escherichia coli BL21(DE3) ΔclpP::cat (SG1146) reference54 N/A
Oligonucleotides
CLPP Exon 1 pX330 F:
CACCGAAGCCGACCGGGGCGTGCGG
This paper N/A
CLPP Exon 1 pX330 R:
AAACCCGCACGCCCCGGTCGGCTTC
This paper N/A
CLPP Exon 1 ssODN:
GCATGACGCCACCCGGGCCCCCCCTACCAATATTCATTATTATCACCTTCCGCACGCCCCGGTCGGCTTCCGTCCGATGGCGGAACTACAGCTTCCGGCG
This paper N/A
CLPX Exon1 pX330 F:
CACCGCGGTGCTTGTACTTGCGGCG
reference6 N/A
CLPX Exon1 pX330 R:
AAACCGCCGCAAGTACAAGCACCGC
reference6 N/A
CLPX Exon1 ssODN:
GGCCTCGCGGAGATGCCCAGCTGCGGTGCTTGTACTTGCGGCGCGGCGTAGGTCCGGCTCATCACCTCCTCACTCGCCTCCGCGCAGAGA
reference6 N/A
Recombinant DNA
pX330 reference48 RRID:Addgene_42230
pX330-CLPP KO This paper N/A
pX330-CLPX KO reference6 N/A
pETSUMO2-CLPP(-MTS) reference6 N/A
pETSUMO2-TFAM(-MTS) This paper N/A
Software and Algorithms
Proteome Discoverer 2.2 Thermo-Fisher Scientific RRID:SCR_014477
WebLogo 2.8.2 reference44 RRID:SCR_010236
AlphaFold reference39 N/A
NIS-Elements Basic Research Software Nikon RRID:SCR_002776
XDS reference55 https://xds.mr.mpg.de/
Phenix reference46 https://phenix-online.org/
COOT reference45 http://www2.mrc-lmb.cam.ac.uk/Personal/pemsley/coot
PISA reference47 https://www.ebi.ac.uk/pdbe/pisa/
The PyMOL Molecular Graphics System Schrödinger, LLC https://pymol.org/2/
Other
BbsI New England Biolabs Cat#R0539S
FastAP Thermo-Fisher Scientific Cat#EF0651
T4 Polynucleotide Kinase New England Biolabs Cat#M0201S
T4 DNA Ligase New England Biolabs Cat#M0202S
EnSpire 2300 Multilabel Reader Perkin-Elmer Cat#655077
P-2000 Laser-Based Micropipette Puller Sutter Instrument Co. Cat#P-2000
EkspertNanoLC 425 HPLC System Eksigent Technologies Cat#Ekspert425
Orbitrap Fusion Lumos Tribrid Mass Spectrometer Thermo-Fisher Scientific Cat#IQLAAEGAAPF ADBMBHQ
Microcon-10kDa Ultracel YM-10 filter unit Millipore Cat#Z648078
C18 Stage Tips Supelco Cat#66883-U
Eclipse 80i fluorescence microscope Nikon RRID:SCR_015572
X-Cite Series 120Q excitation light source Excelitas Technologies https://www.excelitas.com/product/x-cite-120q