Ecto-5′-nucleotidase (Nt5e/CD73)-mediated adenosine signaling attenuates TGFβ-2 induced elastin and cellular contraction

Abstract

Arterial calcification due to deficiency of CD73 (ACDC) is a rare genetic disease caused by a loss-of-function mutation in the NT5E gene encoding the ecto-5′-nucleotidase (cluster of differentiation 73, CD73) enzyme. Patients with ACDC develop vessel arteriomegaly, tortuosity, and vascular calcification in their lower extremity arteries. Histological analysis shows that patients with ACDC vessels exhibit fragmented elastin fibers similar to that seen in aneurysmal-like pathologies. It is known that alterations in transforming growth factor β (TGFβ) pathway signaling contribute to this elastin phenotype in several connective tissue diseases, as TGFβ regulates extracellular matrix (ECM) remodeling. Our study investigates whether CD73-derived adenosine modifies TGFβ signaling in vascular smooth muscle cells (SMCs). We show that Nt5e^−/− SMCs have elevated contractile markers and elastin gene expression compared with Nt5e^+/+ SMCs. Ecto-5′-nucleotidase (Nt5e)-deficient SMCs exhibit increased TGFβ-2 and activation of small mothers against decapentaplegic (SMAD) signaling, elevated elastin transcript and protein, and potentiate SMC contraction. These effects were diminished when the A2b adenosine receptor was activated. Our results identify a novel link between adenosine and TGFβ signaling, where adenosine signaling via the A2b adenosine receptor attenuates TGFβ signaling to regulate SMC homeostasis. We discuss how disruption in adenosine signaling is implicated in ACDC vessel tortuosity and could potentially contribute to other aneurysmal pathogenesis.

INTRODUCTION

Arterial calcification due to deficiency of CD73 (ACDC) is a rare genetic disease in which patients inherit biallelic inactivating mutations in the gene ecto-5′-nucleotidase (NT5E), which encodes the membrane-bound cluster of differentiation 73 (CD73) protein (1). CD73 converts extracellular AMP to adenosine and inorganic phosphate. Mutations in patients with ACDC inhibit CD73 enzymatic activity, drastically reducing the production of adenosine (1–3). Extracellular adenosine binds to one of four (A1, A2a, A2b, or A3) G protein-coupled adenosine receptors (ARs) or can be translocated into the cell via passive diffusion or active transport (4). AR signaling participates in many cellular processes; in the vessels, adenosine signaling controls arterial homeostasis (5–8), exerts cardioprotective effects on the vasculature by protecting against vascular inflammation, and controls vessel remodeling and calcification (3, 5–10).

Vessels in patients with ACDC exhibit medial arterial calcification along the damaged and duplicated elastin fibers, increased connective tissue in the medial layer, tortuosity, and arteriomegaly (11). Proteins that make up the extracellular matrix (ECM) function to maintain a highly structured and stable tissue that adequately responds to arterial pressure (12). Elastin is a cardinal component of the ECM of arteries, consuming ∼50% of arterial wall dry weight (13). Elastin fibers are produced by a series of aggregation and cross linking of cell-secreted tropoelastin. They provide the vessel with mechanical function due to their elasticity and undulated appearance (14, 15). The duplicated brittle and damaged elastin phenotype of ACDC vessels mirrors what is seen in aneurysmal vessels (1, 11). Although underlying mechanisms driving aneurysm formation are complex, the main contributors include the disruption of the elastic lamina and loss of smooth muscle cell (SMC) homeostasis (16, 17). Genetic diseases like Marfan syndrome and Loeys-Dietz syndrome feature aneurysms in different vascular beds as primary disease phenotypes (18). Patients with Marfan syndrome exhibit weakened and dilated vascular beds due to mutations in fibrillin-1, which lead to overactive transforming growth factor beta (TGFβ) pathway signaling (19–21). Calcifications are seen along damaged elastic fibers in the Marfan syndrome (22), similar to small nodules of calcification at sites of broken and duplicated elastic lamina in patients with ACDC (11). There is heterogeneity in Loeys-Dietz syndrome mutations and phenotypes (23). However, one case study highlights a patient with mutations in the TGFBR1 gene, resulting in lower extremity popliteal artery aneurysms (24).

TGFβ molecules are multifunctional cytokines that are present in three isoforms in mammals—TGFβ-1, TGFβ-2, and TGFβ-3. During development, TGFβ-2 is localized and restricted to the tunica media of the vasculature (25). TGFβ facilitates the synthesis of ECM components in SMCs and has also been shown to induce wide-ranging effects, from differentiation to cell growth and proliferation in cancer and cardiovascular diseases (26). TGFβ binding to its cognate TGFβ receptors induced their oligomerization, which in turn leads to the activation of their serine/threonine kinase activity. Small mothers against decapentaplegic (SMAD) factors are the canonical downstream effectors of TGFβ and, upon phosphorylation, they release from TGFβ receptors and complex with SMAD4. This complex then translocates into the nucleus to stimulate the transcription of genes, including those encoding ECM protein (25), actin reorganization (27), SMC-specific markers (28), and contraction of myofibroblasts (29, 30). Cell contraction involves the linking of the SMC contractile unit to elastin fibers. Multiple proteins participate in this process, including integrins, talin, vinculin, and myosin actin and filaments, the latter formed mostly by α-SMA units (31). Thus, TGFβ dysregulation may negatively impact essential cytoskeletal organization, vessel stiffness, and contractility (32).

From the histological observations of tortuous vessels from patients with ACDC and those with connective tissue disorders such as Marfan and Loeys-Dietz syndromes, and the mechanistic studies that link TGFβ signaling to elastinopathies (33), our study sought to investigate whether a lack of Nt5e/CD73 and its downstream adenosine signaling leads to alterations in TGFβ signaling.

MATERIALS AND METHODS

Institutional Review Board Statement

The study was conducted and approved by the Institutional Animal Care and Use Committee of The University of Pittsburgh (protocol code 21079585 on July 1, 2021, and protocol code 18124276 on December 11, 2018).

Animals, Cell Line Generation, and Tissue Preparation

All animal breeding was approved by the Institutional Animal Care and Use Committee at the University of Pittsburgh. Nt5e^−/− C57BL/6J mice (Jackson Labs, RRID: IMSR_JAX:018986) were bred with wild-type C57BL/6J mice (Jackson Labs, RRID: IMSR_JAX:000664) to produce Nt5e^+/− mice, which were then bred to each other to yield Nt5e^−/− mice and Nt5e^+/+ littermate controls. Aortic smooth muscle cells (SMCs) were obtained from three to five 3-mo-old male, and female Nt5e^−/− or Nt5e^+/+ mice, and whole aortas were obtained from mice 10-mo old. Briefly, vessels were dissected, cut into 1- to 2-mm pieces, digested in 0.1% collagenase II (Worthington Biochemical Corporation, Lakewood, NJ) for 4–6 h, then plated and expanded as described previously (34).

Cell Culture

Nt5e^+/+ and Nt5e^−/− SMC lines were isolated from the male and female murine aorta and grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Waltham, MA) supplemented with 20% fetal bovine serum (FBS; R&D Systems, Minneapolis, MN) and 100 U/mL penicillin-streptomycin (P/S; Gibco, Waltham, MA). Cultured cells were used between passages 6 and 17. Growth media was changed every 3 days, and cells were split 1:2 when confluent. Postexpansion, 25,000–50,000 cells/cm² were plated with serum reduced to 10% and grown to confluence. Before all experiments/treatments, cells were serum starved in DMEM with 0.5% FBS for 48 h, incubation under reduced serum conditions has been proven to be a beneficial technique for studying smooth muscle cell remodeling and contractility in vitro (35–39). The number of cell lines utilized per individual experiment is stated in the legend of each figure. Recombinant mouse (2 µg/mL) TGFβ-2 (R&D Systems, Minneapolis, MN) was prepared in 4 mM HCl, 0.1% BSA and used at a working concentration of 5 ng/mL. BAY-60-6583 (Tocris, Minneapolis, MN) was used at 10 µM. Furthermore, 8-Br-cAMP (Sigma-Aldrich, St. Louis, MO) was used at a concentration of 0.5 mM. Blebbistatin (Sigma-Aldrich, St. Louis, MO) was used at a concentration of 5 µM. Inhibitors were dissolved in DMSO (Sigma-Aldrich, St. Louis, MO), which was administered in equal volume as vehicle control.

Transcriptional Analysis

RNA was isolated from cells using the Quick-RNA Miniprep kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol. The concentration of isolated RNA was determined on a spectrophotometer. cDNA was created using the high-capacity cDNA reverse transcription kit (Thermo Fischer, Waltham, MA) according to the manufacturer’s protocol. Gene expression was quantified by RT-PCR on a CFX Connect Real-Time PCR system (Bio-Rad, Hercules, CA) with the following parameters: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 20 s, 58°C for 20 s, 72°C for 1 min. Per reaction, 4 ng/µL cDNA, 1 × SYBR Green (Thermo Fisher, Waltham, MA), and 1 µM each forward and reverse primer were used. Primer sequences are provided in Table 1. Quantification was performed using the 2^−ΔΔCt method with 18 s as the housekeeping gene.

Table 1.

RT-PCR expression primers

Gene	Reverse Primer Sequence 5′→3′	Reverse Primer Sequence 5′→3′	Source
18s	GTAACCCGTTGAACCCCATT	CCATCCAATCGGTAGTAGCG	IDT
Eln	TTCTCCCATTTATCCAGGTG	GAAGATCACTTTCTCTTCCG	IDT
Tgfb1	GGATACCAACTATTGCTTCAG	TGTCCAGGCTCCAAATATAG	IDT
Tgfb2	GAGATTTGCAGGTATTGATGG	CAACAACATTAGCAGGAGATG	IDT
Tgfb3	CTCAGTGGAGAAAAATGGAAC	GGTCGAAGTATCTGGAAGAG	IDT
Tgfbr1	AGGCCAAATATTCCAAACAG	AGATATGAAGAGAGCAGAGTTC	Sigma
Tgfbr2	CCAGGATGAATCTGGAAAAC	TAATCCTTCACTTCTCCCAC	Sigma
Tgfbr3	GGTAGCTGTAGACAAAGATTC	CTGCACCACAATAGAGTTATAG	Sigma
Nt5e	GGACATTTGACCTCGTCCAAT	GGGCACTCGACACTTGGTG	IDT
Cnn1	CAATGTGGGAGTCAAGTATG	TACCCAGTTTGGGATCATAG	Sigma
Tagln	CCAACAAGGGTCCATCCTACG	ATCTGGGCGGCCTACATCA	IDT
Myh11	ATGAGGTGGTCGTGGAGTTG	GCCTGAGAAGTATCGCTCCC	IDT
Acta2	CCCAGACATCAGGGAGTAATG	TCTATCGGATACTTCAGCGTCA	IDT
Col1a1	CGTATCACCAAACTCAGAAG	GAAGCAAAGTTTCCTCCAAG	Sigma
Lox	TCTTCTGCTGCGTGACAACC	GAGAAACCAGCTTGGAACCAG	IDT

Western Blot Analysis

Cells were lysed in 1% CHAPS buffer, containing 150 mM sodium chloride, 25 mM HEPES buffer, and 1 × protease and phosphatase inhibitor (Sigma-Aldrich, St. Louis, MO). Samples were vortexed for 10 min followed by five freeze/thaw cycles, then centrifuged for 10 min at 12,000 g and 4°C. Supernatant protein concentration was determined using Pierce BCA protein assay kit (Thermo Fisher, Waltham, MA). Ten microgram of protein were used in the preparation of lysate with 1 × Pierce LDS sample buffer nonreducing (Thermo Fisher, Waltham, MA) and 1 × NuPAGE sample reducing agent (Novex, Waltham, MA). Lysates were denatured at 95°C for 15 min and then electrophoresed on 4%–20% TGX stain-free polyacrylamide gel (Bio-Rad, Hercules, CA) in 1 × Tris/Glycine/SDS buffer (Bio-Rad, Hercules, CA) at 180 V for 50 min. Protein was transferred onto a 0.2 µm nitrocellulose membrane in prepared 1 × Towbin buffer with ethanol (EtOH) at 1 A and 25 V for 30 min using the Trans-Blot Turbo Transfer System (Bio-Rad, Hercules, CA). Membranes were blocked in 1:1 Odyssey blocking buffer (Li-COR, Lincoln, NE) and PBS for 1 h at room temperature followed by primary antibody incubation in 1:1 Odyssey blocking buffer and PBS plus 0.1% Tween 20 (PBS-T) at 4°C overnight. Membranes were washed in PBS-T three times for 5 min, then incubated in secondary antibody at room temperature for 1 h. Membranes belonging to the same experimental set were imaged simultaneously on an Odyssey CLx (LI-COR, Lincoln, NE), and band intensity quantification was performed with Image Studio (Version 5.2, LI-COR, Lincoln, NE) software. Individual bands were normalized to α-tubulin, and the fold change of each treatment group was compared with the vehicle control lanes of each gel. For sequential antibody incubations, membranes were stripped in 1 × NewBlot Nitro Western Blot Stripping Buffer (LI-COR, Lincoln, NE) for 10 min followed by three washes in PBS. Antibodies used are listed in Table 2.

Table 2.

Western blot antibodies

Antibody	Source	Catalog Number	Working Concentration	Antibody Validation
CNN1	Abcam	ab46794	1:1,000	PMID: 33501750
SM22	Abcam	ab14106	1:750	PMID: 34072818
MYH11	Abnova	MAB3425	1:500	PMID: 21372299
α-SMA	Abcam	ab7817	1:250	PMID: 33976108
α-tubulin	Li-Core	926-42213	1:1,000	PMID: 28698283
P-SMAD2 S465/S467	Cell Signaling	3108s	1:1,000	PMID: 31446224
P-SMAD3 S423/S425	Novus Biologicals	NBP1-77836	1:2,000	PMID: 27356569
SMAD2/3	EMD Millipore	07-408	1:500	PMID: 20648565
MLC2	Cell Signal	8505	1:500	PMID: 34997404
P-MLC2 S19	Cell Signal	3671	1:500	PMID: 35725987
FAK	Cell Signal	130095	1:500	PMID: 35004846
P-FAK Y397	Cell Signal	3283s	1:500	PMID: 35574330
IRDye 800CW Goat anti-Mouse IgG	LI-COR	926-32210	1:10,000	PMID: 33108594
IRDye 800CW Goat anti-Rat IgG	LI-COR	926-32219	1:10,000	PMID: 30717826
IRDye 680RD Goat anti-Mouse IgG	LI-COR	926-68070	1:10,000	PMID: 35250568
RDye 800CW Goat anti-Rabbit	LI-COR	926-32211	1:10,000	PMID: 33108594
IRDye 680LT Goat anti-Rabbit IgG	LI-COR	926-68021	1:10,000	PMID: 30605688

Collagen Gel Contraction Assay

Cells were serum starved in 0.5% FBS for 48 h, trypsinized, and then resuspended to 5 × 10⁵ cells/mL in DMEM supplemented with 10% FBS. Cell-gel mixture was prepared on ice with 50 µL 10 × DPBS at pH 7.1 (Gibco, Waltham, MA), 50 µL 100 mM NaOH, and 400 µL PureCol Bovine Type I Collagen (3 mg/mL; Advanced BioMatrix, Carlsbad, CA), vortexing after each addition. Cell suspension (100 µL) was then added to the mixture and pipetted a maximum of 20 times until the color was even. Cell-gel mixture (50 µL) was pipetted onto nontissue culture treated 3.8 cm² polystyrene wells (Falcon, Corning, NY) as a dome-shaped droplet and incubated at 37°C for 2–4 h. After gelation, 1 mL DMEM with 10% FBS, with experimental treatment as necessary, was added to the wells, and collagen gels were lifted off the plate using cell scrapers. For the duration of the experiments, collagen gel circumference was measured daily on an Evos microscope (Thermo Fisher, Waltham, MA). Media was also changed daily. ImageJ software (National Institutes of Health Bethesda, MD, RRID:SCR_003070) was used in the quantification of collagen gel circumference as a method of measuring contraction.

Immunocytochemistry

Cells and collagen plugs were fixed in 4% PFA made in PBS 0.5% Triton-X 100 for 15 min and then washed three times with PBS 0.5% Triton-X 100 for 5 min each. Cells were then incubated in blocking buffer (PBS, 0.5% Triton-X 100, 5% FBS) at room temperature for 1 h followed by an overnight primary antibody incubation at 4°C. Cells were washed with PBS, 0.1% TWEEN 20 three times for 5 min, and then incubated in secondary antibody for 1 h at room temperature. Cells were washed three times in PBS, 0.1% TWEEN 20, once with PBS for 5 min each wash, and then stained for f-actin with AlexaFluor488 Phalloidin (Molecular Probes, Eugene, OR) for 30 min, washed with PBS and mounted with Fluoroshield mounting medium with DAPI (Abcam, Waltham, MA). Samples were imaged within 24 h of mounting on a fluorescent microscope (Thermo Fisher, Waltham, MA). Antibodies used are listed in Table 3.

Table 3.

Immunocytochemistry antibodies

Antibody	Source	Catalog Number	Working Concentration	Antibody Validation
CNN1	Abcam	ab46794	1:500	PMID: 31506459
SM22	Abcam	ab14106	1:500	PMID: 33843453
MYH11	Abnova	MAB3425	1:200	PMID: 21372299
Normal Rabbit IgG	Cell Signaling	2729s	Same as most concentrated primary antibody	PMID: 31616414
Normal Rat IgG	Santa Cruz Biotechnology	sc-2026	Same as most concentrated primary antibody	PMID: 30700907
Goat anti-rabbit IgG Alexa Fluor 488	Thermo Fisher	A-11008	1:250	PMID: 31506459
Goat anti-rat IgG Alexa Fluor 488	Thermo Fisher	A-11006	1:250	PMID: 35243249

CD73 Enzymatic Activity Assay

Cells were washed three times with prepared inorganic phosphate-free buffer (PiFB), containing 2 mM magnesium chloride, 120 mM sodium chloride, 5 mM potassium chloride, 10 mM glucose, and 20 mM HEPES buffer. Cells were then incubated in 1 mL PiFB for 10 min at 37°C, and 500 µL buffer was collected. Cells were then incubated in 1 mL PiFB with 2 mM AMP (Sigma-Aldrich, St. Louis, MO) for 10 min at 37°C, and 500 µL buffer was collected. Samples were assayed for inorganic phosphate production from exogenous AMP using the SensoLyte MG Phosphatase Assay Kit (AnaSpec, Fremont, CA) according to the manufacturer’s protocol. Inorganic phosphate was quantified at 600 nm utilizing a standard curve and normalized to PiFB incubation.

ELISA

Cells were serum starved for 4 days before media collection. Samples were assayed for TGFβ-2 concentration using a Mouse TGFβ-2 ELISA Kit (PicoKine, Pleasanton, CA) according to the manufacturer’s protocol. The TGFβ-2 ligand was quantified at 450 nm utilizing a standard curve and was normalized to total live cells.

Elastin Quantification Assay

Cells were treated in serum starvation media for 10 days. The media was changed every 4 days. At day 10, cells were trypsinized, and soluble tropoelastins were extracted using the Fastin Elastin Assay Kit, according to the manufacturer’s protocol (Biocolor Life Science Assays, Carrickfergus, United Kingdom). α-Elastin absorbance measurements at 562 nm were quantified and normalized to total live cells.

Verhoeff Van Gieson and Masson’s Trichrome Staining

Mice aortic tissues were removed from mice through a modified bilateral thoracosternotomy under anesthetized conditions. Then aortic tissue was fixed with 10% paraformaldehyde and embedded in paraffin. The embedded specimens were transversely sectioned at 10 µm on a microtome cryostat (Microm HM 325). Slides with the adhered paraffin aortic sections were warmed to 65°C for 1 h and then deparaffinized through xylene, rehydrated with serial incubation in graded alcohol baths, and stained with Verhoeff–van Gieson for elastic fiber visualization (Polysciences, 25089-1) or Masson’s for collagen fibers (Polysciences, 25088-1), according to manufacturer’s instructions. Images were captured using an Evos XL Bright Field Light Microscope (Invitrogen).

RNA Sequencing and Bioinformatics Analysis

Total RNA was extracted using KIT Quick-RNA Mini-prep (Zymo Research) according to the manufacturer’s instructions. RNA quality was validated in a TapeStation (Agilent), and RNA concentration was determined using Qubit Fluorometric Quantification (Thermofisher). Residual rRNAs were removed, and cDNA samples were prepared using Illumina Stranded mRNA (PolyA+) 1-47 (Illumina). cDNA products were ligated to Illumina sequencing adapters and sequenced using the Nextseq 2000 sequencer (Illumina). Adapters ( CTGTCTCTTATACACATCT) were removed during demultiplexing. Raw reads were mapped to the mouse reference genome (Grcm38), and gene abundances were quantified with CLC Genome Workbench (v. 22.0.2). Differentially expressed genes were selected based on a false discovery rate (FDR) <0.05 and −2< log₂ fold change >2. Gene ontology (GO) analyses to determine relevant biological pathways were performed using the Gene Ontology Consortium (http://www.geneontology.org/) system and Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg) using DAVID functional annotation tools (https://david.ncifcrf.gov/), and confirmed using Ingenuity Pathways Analysis (IPA, Qiagen) and CLC Genome Workbench (v. 22.0.2). This data has been uploaded to the Gene Expression Omnibus (GEO) GSE216727.

Statistics

GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, RRID:SCR_002798) was used in statistical analyses. Data are shown as means ± SD. Data containing two groups were analyzed using the nonparametric Wilcoxon–Mann–Whitney test. Data containing more than two groups were analyzed using the nonparametric Kruskal–Wallis test followed by a post-hoc Dunn’s multiple comparison test. Data are presented as means ± SD. A P value ≤ 0.05 was considered significant.

RESULTS

TGFβ-2 Expression Is Increased in Nt5e-Deficient Smooth Muscle Cells

As described previously, histopathological examination of an ACDC patient’s right femoral artery shows multiple areas of internal elastic lamina fragmentation and duplication (Fig. 1A; 11). As patients with ACDC present a generalized disruption to the elastic lamina, we investigated how the absence of functional ecto-5'-nucleotidase enzyme affects the cellular processes that promote smooth muscle cell (SMC) extracellular matrix remodeling, elastin homeostasis, and contractile capabilities. We are not able to obtain SMCs from patients with ACDC; thus, we utilized aortic SMCs isolated from Nt5e^+/+ and Nt5e^−/− mice (Supplemental Fig. S1A; all Supplemental material is available at https://doi.org/10.6084/m9.figshare.21466674.v1). Transcription of Nt5e and CD73 enzymatic activity assay confirmed the genotype of SMC lines (Fig. 1, B and C). To understand the implications of Nt5e deficiency, sequencing of poly-A transcripts (RNA-Seq) was performed. PCA analysis and nonparametric Spearman correlation indicated biological consistency between samples (Supplemental Fig. S2, A and B). A total of 2,649 genes were differentially expressed in the Nt5e-deficient group compared with the Nt5e^+/+ group. Specifically, 1,265 genes were significantly upregulated in Nt5e^−/− SMCs, whereas 1,383 were significantly downregulated (FDR < 0.05 and | log₂ FC| >2; Supplemental Fig. S2C). The distribution and some of the genes addressed in this report are shown in a volcano plot (Fig. 1D). Hierarchical clustering was used to analyze the changes in expression patterns. There was an evident difference in expression patterns of genes between the Nt5e-deficient cells and the Nt5e^+/+ SMC lines (Fig. 1E), which was verified and consistent with qRT-PCR analysis (Supplemental Fig. S2D). For example, we found that Nt5e^−/− SMCs have upregulated Cnn1 and Tagln genes compared with Nt5e^+/+ SMCs at baseline. KEGG and GO functional classification was performed on the resulting differentially expressed genes. KEGG pathway enrichment analyses indicated that Nt5e^−/− SMCs display a reduced fatty acid metabolism, nucleotide metabolism, and PI3K/Akt signaling pathway and reduced focal adhesion capabilities, which would be expected without the ability to breakdown exogenous AMP into adenosine. In contrast, mammalian target of rapamycin (mTOR), AMP-activated protein kinase (AMPK), and Forkhead box O (FOXO) signaling pathways were upregulated (Supplemental Fig. S2E). Enriched GO terms were mainly distributed in pathways related to extracellular component regulation, including extracellular matrix, changes in the component of the plasma membrane, cell junction, and secretion (Fig. 1F). As ACDC vessel morphology exhibits a highly remodeled medial layer where the SMCs reside, we evaluated the levels of the SMC markers muscle marker 22 (SM22, encoded by Tagln gene), calponin (CNN1, encoded by Cnn1 gene), and myosin heavy chain 11 (MYH11; 40, 41). Western blot and immunofluorescence analyses revealed that cultured Nt5e^−/− SMCs have upregulated CNN1 and SM22 genes compared with Nt5e^+/+ SMCs at baseline (Fig. 1, G and H). Together these data show that Nt5e/CD73 and adenosine signaling are involved in the homeostasis of ECM, intracellular signaling pathways, and SMC phenotype.

Figure 1.

Nt5e^−/− SMCs have elevated expression of SMC markers at baseline. A: Verhoeff–Van Gieson staining for elastin fibers in the resected right femoral artery of patient with ACDC. Image reprinted from Mol Genet Metab, Markello et al. (11), with permission from Elsevier. B: transcriptional analysis confirming genetic deletion of the Nt5e gene. n = 4 samples. C: NT5E enzymatic activity analysis confirming enzymatic activity deficiency of Nt5e gene. n = 9 samples. D: distribution of differentially regulated genes in the Nt5e^−/− lines relative to Nt5e^+/+ wild-type SMC lines shown as a volcano plot. log₂FC 2< or >2 and FDR < 0.05. E: hierarchical clustering of the expression profiles in Nt5e^+/+ and Nt5e^−/− SMC lines. Different colors indicate the relative fold expression. F: top 20 pathways of GO analysis of up- and down-regulated genes in the Nt5e^−/− SMC lines. RichScore refers to the score provided by DAVID. The size and the color denote the number of genes and the P value, respectively. G: baseline expression of SMC contractile markers analyzed by Western blot (left). Quantification is shown on the right graphs. n = 7 samples. H: immunofluorescent staining of SMC markers on cells at baseline. Results representative of n = 3 replicates. The scale bar represents 200 μm. P values were calculated by the Mann–Whitney U test (B, C, and G) and indicated on each graph. ACDC, arterial calcification due to deficiency of CD73; FDR, false discovery rate; GO, gene ontology; SMC, smooth muscle cells.

TGFβ-2 Induces SMC and ECM Markers Expression in Nt5e^−/− SMC Lines

GO pathway analysis of our RNA-Seq data identified transcripts of genes related to the extracellular matrix (ECM) as the most elevated. As the elastic lamina disruption in ACDC phenocopies aneurysmal vessels from patients with Marfan syndrome, which stems from mutations leading to overactivation of TGFβ signaling pathway (22), we assessed the expression of several genes in the TGFβ pathway known to contribute to ECM remodeling. Real-time quantitative (RT-q) PCR analysis found Tgfb2 gene expression was significantly upregulated in Nt5e^−/− SMCs compared with Nt5e^+/+ SMCs at baseline with no differences in expression of the three Tgfβ receptors genes (Fig. 2A and Supplemental Fig. S3, respectively). As Nt5e^−/− SMCs secreted more TGFβ-2 from cells than Nt5e^+/+ SMCs at baseline (Fig. 2B), we examined whether exogenous TGFβ-2 alters the SMC phenotype. TGFβ-2 treatment significantly upregulated Cnn1, Tagln, and Acta2 in SMCs at 24 h, and was exacerbated in Nt5e^−/− cells (Fig. 2C). Similarly, we found that CNN1 was significantly upregulated in aortas isolated from Nt5e-deficient mice (Fig. 2D), whereas Verhoeff–Van Gieson and Masson’s trichrome staining revealed stretched elastin fibers in the Nt5e^−/− mice aorta compared with aortas isolated from Nt5e^+/+ mice (Fig. 2E). As compromised elastic lamina correlates with ACDC vessel remodeling and TGFβ signaling regulates remodeling of ECM components in human SMCs (25), we interrogated elastin (Eln) gene expression at baseline and in response to exogenous mouse TGFβ-2 in Nt5e^+/+and Nt5e-deficient SMCs. At baseline, Eln gene expression is upregulated fourfold in Nt5e^−/− SMCs compared with Nt5e^+/+ (Fig. 2F and Supplemental Fig. 4, A and B), and this difference is ∼25-fold 24 h after exogenous TGFβ-2 treatment (Fig. 2G). Transcriptional examination after TGFβ-2 treatment revealed a mild but significant upregulation of collagen 1 gene (Col1a1), a key ECM component, whereas no differences in expression were detected for lysyl oxidase gene (Lox), an enzyme involved in cross-linking collagen and elastin fibers (Fig. 2G). Together, these data show that Nt5e-deficient SMCs exhibit upregulated TGFβ production at baseline, which contributes to increased transcription of elastin and markers of SMC contractility.

Figure 2.

TGFβ-2 induces Eln gene expression upregulation in Nt5e^−/− SMC lines. A: baseline Tgfβ isoforms expression. n = 5 samples. B: secreted mouse TGFβ-2 at baseline. n = 6 samples. C: transcriptional analysis of SMC contractile markers of Nt5e^+/+ and Nt5e^−/− lines treated with mice TGFβ-2 for 24 h. n = 12 samples. D: immunohistochemistry staining of CNN1 in aortas removed from Nt5e^+/+ and Nt5e^−/− mice. Scale bars represent 400 μm. n = 9 mice. E representative images of Verhoeff–Van Gieson staining of elastin fibers (top) and Masson’s trichrome staining of collagen (bottom) in aortas isolated from Nt5e^+/+ and Nt5e^−/− mice. Scale bars represent 100 μm. n = 5 mice. F: representative genomic tracks of each cell line were utilized in the RNA-seq analysis. For each panel, gray tracks are from Nt5e^+/+ wild-type SMC lines; blue tracks are from Nt5e^−/− SMC lines. All tracks in the comparison have the same scaling factor. Limk1 gene is located directly 5′ to the Eln gene on chromosome 5 and serves as a control showing no changes in expression between the groups. G: expression analysis of Nt5e^+/+ and Nt5e^−/− SMC lines treated with TGFβ-2. n = 6 samples. P values were calculated by the Mann–Whitney U test (A, B, and D) and with the Kruskal–Wallis H test (C and G). Significant P values are indicated on each graph. CNN, calponin; SMC, smooth muscle cells; TGFβ, transforming growth factor β.

A2bAR Signaling Attenuates TGFβ-2 Regulated SMAD Phosphorylation in Nt5e-Deficient SMCs

As Tgfβ-2 expression and TGFβ-2 secretion were elevated in Nt5e^−/− SMCs, we investigated SMAD2 and SMAD3 activation, as they are the canonical downstream effectors in the TGFβ signaling axis. Western blot analysis revealed that SMAD2/3 protein levels are significantly elevated in Nt5e^−/− SMCs at baseline relative to Nt5e^+/+ SMCs (Supplemental Fig. S5A). SMCs express A2a, A2b, and A3 adenosine receptors (AR; Supplemental Fig. S5B), and previous studies have shown that activation of adenosine signaling with the high-affinity and specific A2bAR agonist BAY-60-6583 (BAY) prevents calcification of patient with ACDC fibroblasts via stimulating adenylyl cyclase to produce cAMP (2, 3). Thirty minutes of pretreatment with BAY abolished TGFβ-2-mediated phosphorylation of SMAD2 and SMAD3 in SMCs (Fig. 3, A and B). Previous studies have implicated SMAD activation in elastin expression (42, 43). We assessed the secretion of α elastin protein after 10 days of TGFβ-2 treatment and found that elastin protein secretion was significantly elevated in Nt5e^−/− SMCs compared with Nt5e^+/+ SMCs, and this elevation was attenuated with pretreatment with BAY (Fig. 3C). These data show that lack of CD73-mediated A2bAR signaling potentiates TGFβ-2 pathway signaling, suggesting a functional cross talk between A2bAR and TGFβ-2 signaling in the regulation of Eln gene expression.

Figure 3.

Lack of A2bAR signaling potentiates TGFβ-2 signaling. A: Western blot analysis of SMAD2 and SMAD3 phosphorylation treated with TGFβ-2 for 6 h with or without 30-min pretreatment with the A2bAR agonist BAY-60-6583. B: quantification of P-SMAD2 to SMAD3 signals. n = 6 samples. Blots were processed in parallel. C: Fastin elastin assay of cultured SMCs under TGFβ-2 treatment with and without BAY-60-6583 for 10 days. n = 9 samples. P values were calculated by Kruskal–Wallis H test (B and C). Significant P values are indicated on each graph. SMAD, small mothers against decapentaplegic; SMC, smooth muscle cells; TGFβ, transforming growth factor β.

TGFβ-2 Mediated Contraction in Nt5e-Deficient SMCs Is Prevented by A2bAR Activation and cAMP

To determine whether the lack of Nt5e has a consequence in the contractile phenotype of SMCs, we performed a cell contraction assay. Cells were seeded in freshly polymerized floating collagen matrices (Supplemental Fig. S6A). After 4 days of treatment, exogenous TGFβ-2 significantly induced contraction of Nt5e^−/− but not of Nt5e^+/+ SMCs, and activation of A2bAR pathway with BAY prevented TGFβ-2-mediated contraction of Nt5e^−/− SMCs (Fig. 4A), and these differences were not due to differences in SMC proliferation (Supplemental Fig. S6B). TGFβ-2 stimulates F-actin polymerization (44), and we found that TGFβ-2 induced a strong F-actin signal in Nt5e^−/− but not in Nt5e^+/+ SMCs (Supplemental Fig. S6C and Fig. 4B). Further, we determined that Nt5e^−/− contractile phenotype is due to the contractile machinery, as pretreatment with Blebbistatin (Bleb), a potent myosin II inhibitor (45), abolished the contraction of Nt5e^−/− SMCs and the formation of contractile actin fibers (Fig. 4, C and D). Mirroring these results, immunofluorescent staining indicated an increase in MLC2 levels and a significant increase in the phosphorylation of MLC2 (P-MLC2) in Nt5e^−/− SMCs (Supplemental Fig. S6, D and F). Although we also observed an increase in focal adhesion kinase (FAK) levels, we detected no differences in the phosphorylation of FAK between Nt5e^−/− and Nt5e^+/+ SMCs (Supplemental Fig. S6, E and F). Immunofluorescence staining also showed that TGFβ-2 induces robust elastin production in Nt5e^−/− but not in Nt5e^+/+ SMCs, which was reduced when the cells were pretreated with BAY (Fig. 4E). Together, these data suggest that a lack of Nt5e/CD73-mediated adenosine signaling through the A2bAR exacerbates TGFβ-2-induced contraction and excess production of elastin.

Figure 4.

A2bAR activation prevents TGFβ-2-mediated contraction in NT5e^−/− SMCs. A: floating collagen matrices gel contraction assay of Nt5e^+/+ and Nt5e^−/− SMC lines under TGFβ-2 treatments with and without BAY-60-6583 pretreatment for 4 days. n = 23 samples. Scale bars represent 2 mm. Quantification of contraction as total area is shown on the right graph. B: actin fiber immunofluorescent staining of contraction assay matrices treated as in A. Scale bar represents 50 μm. C: floating collagen matrices gel contraction assay of Nt5e^+/+ and Nt5e^−/− SMC lines under TGFβ-2 treatments with and without Blebbistatin pretreatment for 4 days. n = 25 samples. Scale bars represent 2 mm. Quantification of contraction as total area is shown on the right graph. D: contraction fibers immunofluorescent staining of contraction assay matrices treated as in C. Scale bar represents 50 μm. E: actin fibers and elastin protein immunofluorescent staining of contraction assay matrices treated as in A. Scale bars represent 50 μm. P values were calculated by Kruskal–Wallis H test (A and C) and indicated on each graph.

DISCUSSION

We investigated how NT5E/CD73 deficiency contributes to the remodeling of the medial layer of vessels and identified a novel cross talk between adenosine receptor signaling and TGFβ-2 signaling pathways (Fig. 5). Specifically, we observed that Tgfβ2 gene transcription and signaling were elevated in Nt5e^−/− SMCs. We found that the absence of Nt5e/CD73 activity increased SMAD phosphorylation in response to exogenous TGFβ-2, resulting in the upregulation of SMC markers, increased elastin protein production, and an exacerbated contractile state. These increases were alleviated with pharmacological activation of the A2bAR. We also observed that A2bAR signaling modulates the SMAD phosphorylation state. These data suggest cross talk between CD73/adenosine and TGFβ signaling pathways in SMCs.

Figure 5.

Proposed cross talk between adenosine receptor signaling and TGFβ-2 signaling in SMC homeostasis. NT5E/CD73-mediated adenosine signaling opposes TGFβ-2 signaling in regulating SMC and ECM homeostasis. Image created with BioRender and published with permission.

Although Tgfβ2 gene expression is increased in CD73^−/− SMCs at baseline, how TGFβ-2 transcripts are regulated and by which transcription factors remain a question. From our data (Fig. 2B), secreted TGFβ-2 was higher in CD73^−/− SMCs, and exogenous TGFβ-2 treatment led to elevated elastin protein production (Fig. 3C). The tortuous remodeling of patient with ACDC arteries and our findings of enhanced TGFβ signaling in CD73-deficient SMCs is interesting in light of what is known about other genetic vascular diseases with tortuous phenotypes that involve the TGFβ signaling pathway. For instance, Marfan syndrome and Loeys-Dietz syndrome feature thoracic aortic aneurysms and aortic enlargement, respectively, as primary disease phenotypes, and are considered to stem from mutations in several genes that lead to overactivation of TGFβ signaling pathway (18). Patients with Marfan syndrome exhibit weakened and dilated vascular beds due to mutations in fibrillin-1, which lead to overactive TGFβ pathway signaling (19–21). The vascular pathology of these aortopathies phenocopies what is seen in ACDC vessels—tortuosity, damaged and duplicated elastic lamina, with calcification that appears to nucleate at breakpoints (1, 11). However, examination of those genetic aneurysmal diseases linked to TGFβ has revealed contradictory reports of whether hyperactivity or haploinsufficiency is the cause (46, 47). Our present data suggest a role for upregulated TGFβ in CD73 deficiency, which may help to untangle the paradoxical findings of tortuous and/or aneurysmal pathogenesis; perhaps dysregulated CD73 and adenosine signaling may be involved in aneurysm formation, however, this hypothesis remains to be examined.

Canonical TGFβ-2 signaling leads to phosphorylation and activation of SMAD2 and SMAD3 (48). Our data show that SMCs lacking CD73 have increased SMAD2/3 protein levels at baseline (Supplemental Fig. S4A) and exogenous TGFβ-2 treatment induced further increased phosphorylated state of SMAD2 and SMAD3 (Fig. 3). In support of our findings, Vasiukov et al. (49) showed that TGFβ-2 and adenosine signaling could cross talk to regulate protein expression and contraction of mouse mammary fibroblasts. In our in vitro SMC system, we found that pharmacological activation of A2bAR returned SMAD2 and SMAD3 phosphorylation to normal levels (Fig. 3). The A2-subtypes of adenosine receptors (A2a and A2b) stimulate adenylyl cyclase to produce cAMP, a secondary messenger (50). A report has shown that protein kinase A (PKA) suppresses TGFβ/SMAD signaling in keratinocytes (51). As PKA is directly downstream of cAMP, perhaps it may be involved in the attenuation of SMAD2 and SMAD3 phosphorylation in SMCs as well. Alternatively, A2bAR may recruit inhibitory SMAD, such as SMAD7 by an unknown mechanism, that results in the ubiquitination and degradation of SMAD2/3 (26). Based on our findings, we establish that there is cross talk between A2bAR and TGFβ signaling pathways in modulating SMC gene expression, but further work is needed to fully understand this signaling axis.

Our RNA-Seq data illustrates that at baseline, Nt5e^−/− SMCs exhibit expression of genes involved in the regulation or production of the ECM (Fig. 1). Many studies have shown a role for TGFβ in ECM remodeling in SMCs (25, 52), and we found Tgfβ2 gene transcription and secretion to be elevated in Nt5e^−/− SMCs (Fig. 2). We sought to examine TGFβ-2 function specifically on elastin in the absence of CD73 activity since elastic lamina dysregulation is readily observed in patients with ACDC vessels (Fig. 1) and in the vessels of patients with connective tissue disorders (11, 21). Tgfβ2 and Eln genes have increased expression in Nt5e^−/− SMCs at baseline, and exogenous TGFβ-2 further increases Eln gene expression relative to Nt5e^+/+ SMCs. Our findings align with previous studies exploring the role of TGFβ in regulating elastin expression (53). TGFβ-2-induced secretion of elastin protein is attenuated upon A2bAR activation, suggesting that adenosine and TGFβ signaling may cooperate during ECM remodeling.

In our present study, we showed that in an absence of CD73, SMC contractile markers calponin and SM22 are elevated relative to Nt5e^+/+ cells, and exogenous TGFβ-2 treatment further upregulates their gene expression (Fig. 2). TGFβ has been shown to increase αSMA during lung myofibroblast differentiation (54), and our data show that Cnn1 and Acta2 are upregulated in Nt5e^−/− SMCs by TGFβ-2, and activation of A2bAR signaling attenuates this increase. We see this functionally as well when we observed TGFβ-2 induced contraction in Nt5e^−/− SMCs that was mitigated with concomitant activation of A2bAR (Fig. 4). Although our data suggest a cross talk between canonical TGFβ/SMAD signaling and A2bAR signaling, the precise mechanism by which these pathways intersect remains to be determined. Reports have hinted at a potential answer to this question where it was shown that RhoA-GTP levels are enhanced in SMCs (55, 56). RhoA is known to induce actin organization and cell contraction (57). TGFβ has also been shown to induce cytoskeletal organization via RhoA signaling cascade in pulmonary endothelial cells (58). Furthermore, the CD73/A2bAR axis functions to interact with actin cytoskeleton in epithelial cells (59). Jointly, these findings may help uncover the signaling mechanism behind actin fiber organization and contraction in Nt5e deficiency and potentially other tortuous genetic diseases.

The elastin contractile unit of SMCs is a critical feature in regulating vascular tone. Our data demonstrate that Nt5e/CD73-deficient SMCs are more contractile when stimulated with TGFβ-2. Although we show increased Nt5e^−/− SMC contraction and increased elastin remodeling, a broken and duplicated elastic lamina, and thus a damaged elastin contractile apparatus, may perhaps be promoting ACDC tortuosity. Although our present study examines the effects of TGFβ-2 on Nt5e/CD73 deficiency in SMCs, the impact of mechanical forces may also be of importance. Tortuosity is most notable in the arteries behind the knee of patients with ACDC, where flexion and extension exist and mechanotransduction of SMCs can modulate contractile functions (60). The calcium-dependent and Rho/Rho-associated protein kinase pathways have been shown to be interlinked in regulating SMC contraction (61). It is likely that mechanical stimuli triggers additional TGFβ release, further exacerbating aberrant ECM remodeling and contributing to vessel tortuosity in ACDC (62, 63). It is also important to note that secretion of TGFβ-2 from Nt5e^−/− SMCs in one area of the vessel would also impact neighboring Nt5e^−/− SMCs. TGFβ-2 secretion would be elevated by SMCs in the area of joints, such as the iliac or popliteal arteries, and once secreted, could potentially travel further in the vessel, propagating an elevated TGFβ pathway response. The role of mechanical stretch in Nt5e/CD73 deficiency on ECM remodeling and SMC contraction will be further investigated.

Altogether, our study shows that there is cross talk between A2bAR and TGFβ-2 signaling in the context of Nt5e/CD73 deficiency with upregulated elastin production, contraction, and actin staining. Our findings provide a starting point for elucidating the underlying mechanisms that drive ACDC tortuosity and extracellular matrix remodeling in this disease state and may provide insight regarding additional pathways that may contribute to aneurysm formation.

DATA AVAILABILITY

Original Western blot images can be found at https://doi.org/10.6084/m9.figshare.21466680.v1.

SUPPLEMENTAL DATA

Supplemental Figs. S1–S6: https://doi.org/10.6084/m9.figshare.21466674.v1.

GRANTS

This research was funded by National Institutes of Health, Grant No. K22 HL117917.

DISCLOSURES

The authors declare that the research was conducted without any commercial or financial relationships construed as a potential conflict of interest.

AUTHOR CONTRIBUTIONS

C.S.H. conceived and designed research; R.A.C., R.W., P.J., W.J.M., C.C.C., J.C., A.C., C.K.B., A.M.P., A.P., and P.B. performed experiments; R.A.C., R.W., P.J., W.J.M., C.C.C., J.C., A.C., C.K.B., A.M.P., A.P., P.B., and C.S.H. analyzed data; R.A.C., R.W., P.J., W.J.M., C.C.C., J.C., A.C., C.K.B., A.M.P., P.B., and C.S.H. interpreted results of experiments; R.A.C., R.W., and C.S.H. prepared figures; R.A.C., R.W., and C.S.H. drafted manuscript; R.A.C., R.W., C.C.C., and C.S.H. edited and revised manuscript; R.A.C., R.W., P.J., W.J.M., C.C.C., J.C., A.C., C.K.B., A.M.P., A.P., P.B., and C.S.H. approved final version of manuscript.