Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) |
C57BL/6 mice | Charles River or Preclinical Experimental Animal Center University Hospital Erlangen |
||
| Strain, strain background (Mus musculus) |
MINCLE knockout mice | Consortium for Functional Glycomics | Clec4e-/- | Wells C et al. 2007J Immunol PMID:18490740 |
| Strain, strain background (Mus musculus) |
FcRγ knockout mice | Prof. Dr Falk Nimmerjahn, Erlangen, Germany | Fcer1g-/- | Takai T et al. 1994Cell PMID:8313472 |
| Strain, strain background (Mus musculus) |
4-13ko mice | Prof. AN McKenzie, Cambridge, UK |
Il4-/- Il13-/- | McKenzie et al., 1999 J Exp Med PMID:10330435 |
| Antibody | Rat monoclonal anti- mouse Mincle (# 4A9) Unlabeled |
MBL | MBL-D292-3 | 1:200 dilution |
| Antibody | Rat monoclonal IgG1 Isotype unlabeled |
eBioscience | 17-4812-82 | 1:200 dilution |
| Antibody | Rat monoclonal anti- mouse CD3-APC-eF780 |
eBioscience | 47-0031-82 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse CD19-APC-eF780 |
eBioscience | 47-0193-82 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse NK1.1-APC-eF780 |
eBioscience | 47-5941-82 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse CD11b-FITC |
Biolegend | 101206 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse SiglecF-BV421 |
BD | 562681 | 1:400 dilution |
| Antibody | Rat monoclonal anti- mouse Ly6C-PerCP-Cy5.5 |
Biolegend | 128012 | 1:200 dilution |
| Antibody | Rat monoclonal anti- mouse Ly6G-PE-Cy7 |
Biolegend | 127618 | 1:400 dilution |
| Antibody | Human monoclonal anti-mouse Dectin1-APC |
Miltenyi | 130-102-250 | 1:50 dilution |
| Antibody | Human monoclonal anti-mouse Dectin2-APC |
Miltenyi | 130-116-911 | 1:50 dilution |
| Antibody | Human IgG1 APC (Isotype for Dectin2, Dectin1) |
Miltenyi | 130-113-446 | 1:50 dilution |
| Chemical compound, drug |
Mouse Fixable viability dye eF506 |
eBioscience | 65-0866-18 | 1:1000 dilution |
| Antibody | Rat IgG1 APC | eBioscience | 17-4301-81 | 1:200 dilution |
| Antibody | Rat IgG1 APC Iso k | eBioscience | 14-4301-82 | 1:200 dilution |
| Sequence- based reagent |
Mincle Primer (qRT-PCR) |
Metabion | For: gctcacctggtggttatcg Rev: aggttttgtgcgaaaaagga |
|
| Sequence- based reagent |
Mcl Primer (qRT-PCR) | Metabion | For: agtaacgtgcatccgagagg Rev: taacaggacagcaggtccaa |
|
| Sequence- based reagent |
Dectin2 Primer (qRT-PCR) |
Metabion | For: cagtgaagggactatggtgtca Rev: ggagccaaatgacttccagt |
|
| Sequence- based reagent |
Dectin1 Primer (qRT-PCR) |
Metabion | For: atggttctgggaggatggat Rev: atggttctgggaggatggat |
|
| Sequence- based reagent |
Hprt Primer (qRT-PCR) |
Metabion | For: tcctcctcagaccgctttt Rev: cctggttcatcatcgctaatc |
|
| Sequence- based reagent |
Mincle Probe | Roche | Roche Universal Probe Library (UPL) | #15 |
| Sequence- based reagent |
Mcl Probe | Roche | Roche UPL | #1 |
| Sequence- based reagent |
Dectin2 Probe | Roche | Roche UPL | #89 |
| Sequence- based reagent |
Dectin1 Probe | Roche | Roche UPL | #60 |
| Sequence- based reagent |
Hprt Probe | Roche | Roche UPL | #95 |
| Recombinant DNA reagent |
Minicircle DNA encoding IL-4 | Dr Stefan Wirtz, Erlangen, Germany | ||
| Strain, strain background (bacteria) |
Mycobacterium bovis
BCG DsRed Danish |
Dr Anca Dorhoi, Friedrich Löffler Institute, Greifswald, Germany | ||
| Strain, strain background (helminth) |
Nippostrongylus brasiliensis | Dr David Vöhringer, Erlangen, Germany | 500 L3 larvae per mouse s.c. | |
| Strain, strain background (helminth) |
Schistosoma mansoni | Dr Clarissa Prazeres da Costa, Munich, Germany | NMRI strain | 100 cercariae per mouse s.c. |
| Other | CpG ODN1826 | TIB MOLBIOL | 180000237 | 0.5 μM (in vitro); 10 nmol per mouse in vivo |
| Other | CAF01 (TDB+DDA liposomes) |
Dr Dennis Christensen, Statens Serum Institute, Copenhagen, Denmark | Adjuvant, 50 µl injected s.c. together with H1 protein |
|
| Other | G3D6A liposomal formulation |
Dr Christian Alexander, Research Center Borstel |
Adjuvant, 50 µl injected s.c. together with H1 protein |
|
| Peptide, Recombinant protein |
H1 Mycobacterial antigen |
Dr Dennis Christensen, Statens Serum Institute, Copenhagen, Denmark | H1 is a fusion protein of Ag85B and ESAT-6. 2 µg H1 in 100 μl CAF01 for immunization and 1 μg/ml for re-stimulation |
|
| Peptide, Recombinant protein |
Recombinant murine IL-4 | PeproTech | 214–14 B | 10 μg/ml for in vitro stimulation |
| Peptide, Recombinant protein |
Purified anti-CD3 e | Biolegend | 100302 | 0.5 μg/ml re-stimulation |