Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | Vglut3-Cre (VC) |
Jung et al., 2015b; Vogl et al., 2016 |
PMID:26034270 PMID:27458190 |
Coding sequence for Cre inserted in start codon of Vglut3/Slc17a8 gene on BAC RP24-88H21 |
| Strain, strain background (Mus musculus) | Vglut3-Ires-Cre-KI (KI) | Lou et al., 2013; Vogl et al., 2016 | PMID:23325226; PMID:27458190 | Knock in of ires-Cre cassette 3 |
| Strain, strain background (Mus musculus) | B6.Cg-Gt(ROSA)26Sortm32(CAG-COP4*H134R/EYFP)Hze/J, common name: Ai32 |
Madisen et al., 2012 | Strain #:024109, RRID: IMSR_JAX:024109 | |
| Strain, strain background (Mus musculus) | C57BL/6J | Jackson Laboratory | Strain #: 000664 RRID:IMSR_JAX:000664 |
|
| Antibody | Chicken anti-GFP (polyclonal) | Abcam | Cat. #: ab13970; RRID: AB_300798 | IF; Concentrations used: 1:500 |
| Antibody | Rabbit anti-myo6 (polyclonal) | Proteus Biosciences | Cat. #: 25–6791; RRID: AB_10013626 | IF; Concentrations used: 1:200 |
| Antibody | Mouse anti-CtBP2 (monoclonal) | BD Biosciences | Cat. #: 612044; RRID: AB_399431 | IF; Concentrations used: 1:200 |
| Antibody | Mouse anti-neurofilament 200 (monoclonal) | Sigma | Cat. #: N5389; RRID: AB_260781 | IF; Concentrations used: 1:400 |
| Antibody | Rabbit anti-Vglut3 (polyclonal) | SySy | Cat. #: 135 203; RRID: AB_887886 | IF; Concentrations used: 1:300 |
| Antibody | Goat anti-chicken Alexa Fluor 488 (polyclonal) | Invitrogen | Cat. #: A11039; RRID: AB_2534096 | IF; Concentrations used: 1:200 |
| Antibody | AbberiorStar 580 goat-conjugated anti-rabbit (polyclonal) | Abberior | Cat. #: 2-0012-005-8; RRID: AB_2810981 | IF; Concentrations used: 1:200 |
| Antibody | AbberiorStar 635p goat-conjugated anti-mouse (polyclonal) | Abberior | Cat. #: 2-0002-007-5; RRID: AB_2893232 | IF; Concentrations used: 1:200 |
| Antibody | Goat anti-mouse Alexa Fluor 647 (polyclonal) | Invitrogen | Cat. #: A-21236; RRID: AB_2535805 | IF; Concentrations used: 1:200 |
| Antibody | Goat anti-rabbit Alexa Fluor 568 (unknown) | Thermo Fisher | RRID: AB_143157 | IF; Concentrations used: 1:200 |
| Sequence-based reagent | Ai32 recombinant_foward | This paper | PCR primers | 5’ – GTGCTGTC TCATCATTTTGGC – 3 |
| Sequence-based reagent | Ai32 recombinant_reverse | This paper | PCR primers | 5’ – TCCATAATCCATGGTGGCAAG – 3 |
| Sequence-based reagent | CGCT recombinant_foward | This paper | PCR primers | 5’ – CTGCTAACCATGTTCATGCC – 3‘ |
| Sequence-based reagent | CGCT recombinant_reverse | This paper | PCR primers | 5’ – TTCAGGGTCAGCTTGCCGTA – 3‘ |
| Software, algorithm | Patchers Power Tools | Igor Pro XOP (http://www3.mpibpc.mpg.de/groups/neher/index.php?page=software) | RRID: SCR_001950 | |
| Software, algorithm | ImageJ software | ImageJ (http://imagej.nih.gov/ij/) | RRID: SCR_003070 | |
| Software, algorithm | Fiji software | Fiji (http://fiji.sc) | RRID: SCR_002285 | |
| Software, algorithm | Imaris | Oxford Instruments (http://www.bitplane.com/imaris/imaris) | RRID:SCR_007370 | |
| Software, algorithm | Excel | Microsoft (https://microsoft.com/mac/excel) | RRID:SCR_016137 | |
| Software, algorithm | GraphPad Prism software | GraphPad Prism (https://graphpad.com) | RRID:SCR_002798 | |
| Software, algorithm | Igor Pro software package | Wavemetrics (http://www.wavemetrics.com/products/igorpro/igorpro.htm) |
RRID: SCR_000325 | |
| Software, algorithm | SerialEM | Mastronarde, 2005 (https://bio3d.colorado.edu/SerialEM/) | PMID:16182563 | |
| Software, algorithm | 3dmod |
Kremer et al., 1996 (https://bio3d.colorado.edu/imod/doc/3dmodguide.html) |
PMID:8742726 | |
| Software, algorithm | IMOD | http://bio3d.colorado.edu/imod | RRID: SCR_003297 | Generating tomograms using the ‘etomo’ GUI of IMOD |
| Software, algorithm | Gatan Microscopy Suite | http://www.gatan.com/products/tem-analysis/gatan-microscopy-suite-software | RRID: SCR_014492 | Digital micrograph scripting |
| Software, algorithm | Patchmaster or Pulse | HEKA Elektronik, (http://www.heka.com/products/products_main.html#soft_pm) | RRID: SCR_000034 | |
| Software, algorithm | MATLAB | http://www.mathworks.com/products/matlab/ | RRID: SCR_001622 | |
| Others | IMARIS routine: Source code 1 | This paper | N/A | To analyze the number of ribbons per IHC. Related to Figure 1D |
| Others | IgorPro routine: OptoEPSCs (Source code 2) |
This paper | N/A | For light-evoked EPSCs. Related to Figure 4C–F |
| Others | MATLAB routine: HPMacquire (Source code 3) |
This paper | N/A | To control light pulse for Opto-HPF in a computer interface. Related to Figure 3A |
| Others | MATLAB routine: Intensityprofilecalculator (Source code 4) |
This paper | N/A | For irradiance analysis. Related to Figure 3E |
| Others | MATLAB routine: HPManalyse (Source code 5) |
This paper | N/A | For sensor data alignment. Related to Figure 5C |