| gene | primer | sequence |
|---|---|---|
| sigA | forward | gggctacaagttctcgacct |
| reverse | ccgagcttgttgatcacctc | |
| sugC | forward | gccgtcaaagagttctcgat |
| reverse | caatcatgttgagcgtggtc | |
| lpqY | forward | atgtggagaaccagcgctac |
| reverse | cgggtacttcttctggaacg |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.