Skip to main content
NCBI home page
Asian Pacific Journal of Cancer Prevention : APJCP logoLink to Asian Pacific Journal of Cancer Prevention : APJCP
. 2022 Nov;23(11):3923–3930. doi: 10.31557/APJCP.2022.23.11.3923

The Effects of Vernonia cinerea Less Extracts on Antioxidant Gene Expression in Colorectal Cancer Cells

Jidapa Pakpisutkul 1, Jinjuta Suwapraphan 1, Nattanaporn Sripayak 1, Nattapoom Sitkhuntod 1, Sukritta Loyrat 1, Waraporn Yahayo 1, Roongtawan Supabphol 1,*
PMCID: PMC9930942  PMID: 36444606

Abstract

Objectives:

To investigate the capability of Vernonia cinerea extracts to disrupt the intracellular oxidative-antioxidative status in colorectal cancer cells.

Methods:

All experiments were conducted on two colorectal cancer cell lines (SW620 and HT29) with aqueous and ethanol extracts of Vernonia cinerea (VC). The cytotoxicity of both extracts was evaluated using MTT assay. Cells were treated for 1, 4, and 7 days with different concentrations of aqueous and ethanol extracts ranging from 100-700 and 10-150 μg/ml respectively. The antioxidant capacity of cell lysates was determined by the 2, 2’-azino-bis-(3-ethylbenzothiazolin-6-sulfonic acid) diammonium salt (ABTS), 2, 2-diphenyl-1-picryl-hydrazyl-hydrate (DPPH) radical scavenging activities, and malondialdehyde (MDA) inhibitory effect. The possible action mechanism was also investigated through gene expression of antioxidant enzymes, i.e. superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase.

Results:

Both aqueous and ethanol extracts showed dose/time-dependent manners in all assays. Ethanol extract had a higher potency for cytotoxicity with obviously lower IC50 and a higher antioxidant capability in cytoplasmic content than aqueous extract, especially at 4-day treatment. Low MDA content and gene expression alteration of four enzymes involved in antioxidant status were found in cells treated with ethanol extract compared to aqueous extract.

Conclusions:

Ethanol VC extracts can cause cytotoxicity to human colorectal cancer cells, possibly be involved in oxidative stress, and/or interfere with oxidative-antioxidative balance by radical scavenging in vitro.

Key Words: Vernonia cinerea, cytotoxicity, DPPH, ABTS, MDA, antioxidant enzymes

Introduction

Cancer is one of the major public health problems with a rapidly rising prevalence in people under the age of 50. Colorectal cancer is the third most lethal malignancy in the world. This cancer is caused by multiple factors (Akimoto et al., 2021; Catalano et al., 2021; Vernia et al., 2021). One of the most important mechanisms of the development of colorectal cancer is intracellular oxidative stress caused by an imbalance between the production of reactive oxygen (ROS) and/or nitrogen (RNS) species and the neutralization efficiency of enzymatic and non-enzymatic antioxidants. The exposure to risk factors, such as smoking, stress, alcohol, toxins, and inflammatory processes can cause overproduction of ROS which is closely related to the development of colorectal cancer. Increase of ROS level may lead to redox imbalance and tumor initiation and progression by activation of redox-responsive signaling cascades that promotes abnormal cell growth. It has been confirmed that oxidative stress can be involved in the development of malignant tumors through genetic mutations, initiation of DNA damage, inhibition of apoptosis, promotion of proliferation, differentiation, and migration of malignant cells (Cao et al., 2021; Vecchiotti et al., 2021; Zińczuk et al., 2019). However, little is known about the diagnostic utility of oxidative stress/redox parameters in patients with colorectal cancer (Boakye et al., 2020). Oxidative stress has been a focus point in cancer therapy. There are many reports on colorectal cancer therapy via oxidative stress reduction using natural compounds (Chok et al., 2021; Cruz et al., 2021; Koyuncu et al., 2021; Lau et al., 2021; Wang et al., 2021).

Vernonia cinerea Less. (VC) of Asteraceae Family is a slender stemmed plant, with different leaf shapes and pinkish-purple and numerous flower heads. This plant is known and recommended in Thai traditional medicine, as in other countries, for smoking cessation, asthma, cough, fever, malaria, urinary calculi, arthritis, inflammation, diabetes mellitus, renoprotection, anticancer, antiviral, and antimicrobial activities (Dogra et al., 2014; Puttarak et al., 2018; Toyang et al., 2013; Supabphol et al., 2013). Unfortunately, there is little scientific data available for details of the mentioned effects. Cancer studies have shown that VC has cytotoxicity to cancer cells mainly due to the action of apoptosis. The inhibition of multi-drug resistance transporters or drug efflux pump and STAT3-STAT2 phosphorylation has been mentioned as an interesting mechanism (Appadath et al., 2014; Beeran et al., 2020; Khay et al., 2012; Pouyfung et al., 2019). In addition, VC possesses both cytotoxic and antimetastatic effects on lung cancer cells (Maiti et al., 2021; Pratheeshkumar and Kuttan, 2011a). Amuthan et al. (2020) reported the protective effects of cisplatin-induced nephrotoxicity in cancer therapy. VC can ameliorate the immunosuppression and oxidative stress caused by cyclophosphamide and gamma radiation (Pratheeshkumar and Kuttan, 2010; Pratheeshkumar and Kuttan, 2011b). Flavonoids and sesquiterpene, especially vernolide-A, are the bioactive compounds of VC (Pratheeshkumar and Kuttan, 2011c; Pratheeshkumar and Kuttan, 2011d; Pratheeshkumar and Kuttan, 2012; Rajamurugan et al., 2011; Zhang et al., 2019). The aim of this study was to explore the effects of Vernonia cinerea extracts on disruption of the intracellular oxidative-antioxidative activities in colorectal cancer cells.

Materials and Methods

Plant extract

The aerial parts of VC were purchased locally from local markets at Bangkok, Thailand in December, 2018 and identified by an expert taxonomist, Prof Wandee Gritsanapun, PhD, Faculty of Pharmacy, Mahidol University, Thailand. A voucher specimen (SWU-PY-1802) was deposited at the Department of Physiology, Faculty of Medicine, Srinakharinwirot University, Thailand after authentication. The identified plant was dried at 45°C and powdered. The powder was extracted twice by hot water at 70-80°C and spray-dried. For ethanol extract, the plant powder was then extracted twice with 95% ethanol for 24 h, and evaporated under reduced pressure at 50°C. The yield of aqueous (VC-HSD) and ethanol (VC-EtOH) extracts were 7.99 and 7.5% wt/wt respectively. The ethanol extract was redissolved in a minimum volume of dimethyl sulfoxide for in vitro studies. Both extracts were kept in amber bottles in the refrigerator for further uses.

Cell line and cell culture

Human colorectal cancer cell lines (SW620 and HT29) were donated by the Institute of Biotecnology and Genetic Engineering, Chulalongkorn University, Thailand. The cells were grown in Dulbecco′s Modified Eagle′s Medium containing 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. The cells were maintained in an atmosphere of 95% air and 5% CO2 at 37˚C. In addition, the cells were regularly confirmed for mycoplasma contamination every two months.

Chemicals and reagents

Cell culture medium and supplements were procured from Gibco BRL Life Technologies (Grand Island, NY, USA). 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS•+), 2,2–diphenyl–1–picrylhydrazyl (DPPH), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), dimethyl sulfoxide and BCA protein assay kit were purchased from Sigma-Aldrich (St Louis, USA). TRIzol reagent was ordered from Thermo Fisher Scientific, Inc., USA and SuperScriptTM Reverse Transcriptase kit was obtained from Invitrogen, USA.

Cell viability assay

The cells were seeded at a density of 7 × 104 cells/ml in 24-well plates, maintained for 24 h and treated with aqueous and ethanol extracts of VC for 1, 4 and 7 days at concentrations ranging from 100-700 and 10-150 μg/ml. At the end of incubation, the culture medium was removed and cells were incubated again with 1 mg/ml MTT solution for three hours. The absorbance was then determined at 570 nm using enzyme-linked immunosorbent assay (ELISA) microplate reader (Biotex-synergy-HT). All experiments were performed in triplicate. The cell viability was calculated as a percentage of the control (untreated cells). Inhibitory concentration at 50 % (IC50) growth was used to compare cell viability in the presence and absence of VC extract (Yahayo et al., 2013; Tangjitjaroenkun et al., 2021). IC50 of standard anticancer drug, doxorubicin, was used as positive control to confirm invariable status of cancer cells for cell viability assay.

Cell lysates

Cell lysates were prepared as described by the manufacturer (Lipid peroxidation (MDA) assay kit (ab118970); Abcam, UK). Briefly, after approaching 90 % confluence, the treated cells were washed with cold phosphate buffer saline (PBS), homogenized on ice in lysis buffer solution, and centrifuged to remove insoluble content. The supernatant was collected and protein was calibrated by BCA protein assay kit. The cell lysates were continued for DPPH, ABTS, and MDA assays.

DPPH assay

Free radical scavenging activity was determined using DPPH assay. The DPPH (0.1 mM) was prepared in 100% ethanol and cell lysates were added into the DPPH solution. The reaction mixture was shaken thoroughly and left at room temperature for 30 min. The decrease in absorbance of the resulting solution was monitored at 517 nm using ELISA microplate reader. The control was done by adding the distilled water into the DPPH solution instead of cell lysate. Butylated hydroxy toluene was used as reference. The percentage of DPPH decolorization of cell lysates was calculated as DPPH radical scavenging activity (difference absorbance of control and extract (or standard) x100) / absorbance of control.

ABTS assay

The ABTS cation radical (ABTS•+) was obtained by mixing the stock solution of 7 mM ABTS solution and 2.4 mM potassium persulphate in equal quantities and leaving the mixture in the dark for at 14 hours at room temperature before use. The ABTS•+ solution was then diluted to an absorbance 0.7 ± 0.01 at 736 nm. Cell lysates were allowed to react with ABTS solution for seven minutes. Absorbance was then monitored at 736 nm using ELISA microplate reader. The percentage of ABTS decolorization of the sample was calculated like that of DPPH assay.

Lipid peroxidation assay

The measurement of thiobarbituric acid-reactive substances (TBARS) is a well-established method for detecting lipid peroxidation. This study used the TBARS assay for the rapid detection of the thiobarbituric acid-malondialdehyde (TBA-MDA) adduct at 532 nm using Lipid peroxidation (MDA) assay kit (ab118970, Abcam, UK) following the manufacturer’s instructions.

Real-time quantitative PCR

After treatment with VC extracts, cells were washed with PBS, harvested, and total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc., USA) in accordance with the manufacturer’s instructions. The purity and integrity of total RNA was checked at 260/280 nm ratio. cDNA was synthesized from 1.0 μg of total RNA using a SuperScriptTM Reverse Transcriptase kit (Invitrogen, USA). Gene expression of four antioxidant enzymes, superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx) and glutathione reductase (GRx) was quantified and compared with an internal control (GAPDH) using quantitative real-time PCR in CFX96 Touch Real-Time PCR Detection System (BIO-RAD, USA) (Yahayo et al., 2013; Tangjitjaroenkun et al., 2021).

Statistical analysis. All experiments were performed at least three times with water as the negative control. All data including IC50 values were expressed as the mean and standard deviation (SD). One-way ANOVA and Student’s t-test were used to test the significant differences between groups (SPSS IBM Singapore Pte Ltd; Registration No.1975-01566-C) (P-value<0.05).

Results

Cell viability assay

Two human colorectal cancer cell lines, SW620 and HT29, were exposed to serial dilutions of aqueous and ethanol VC extracts through MTT assay as described previously. Dose-response curves (% survival and at least five concentrations of VC extracts) of three independent sample preparations were used to evaluate average IC50 values. As indicated in Figure 1, both aqueous and ethanol extract graphs showed dose- and time-dependent manner. Ethanol extract showed remarkably more effectiveness with clearly lower IC50 in both cell lines. Aqueous extract had IC50 values ranging from 300 to 800 µg/mL which was more than 3-8 folds higher than that of ethanol extract with IC50 values lower than 100 µg/mL.

Figure 1.

Figure 1

Open in a new tab

IC50 from Cytotoxicity of Aqueous and Ethanol VC Extracts in SW620 and HT29 after Receiving Treatment for 1, 4 and 7 Days. Data were expressed in mean ± SD of three independent experiments

DPPH assay

Intracellular free radical scavenging capability of cells treated with aqueous and ethanol VC extracts was tested by DPPH radical scavenging assay. VC concentration at 50 μg/ml of both extracts were chosen in this study to compare the antioxidant power. Cell lysates from cells exposed to ethanol extract showed a higher antioxidant capability than aqueous extract, especially in the 4-day treatment group (Figure 2).

Figure 2.

Figure 2

Open in a new tab

% Inhibition of DPPH Radical of Cell Lysates in SW620 and HT29 Grown in Aqueous and Ethanol VC Extracts for 1 and 4 Days at Concentration of 50 μg/ml. Data were expressed in mean ± SD of three independent experiments

ABTS assay

ABTS assay was also used to assess intracellular free radical scavenging capability of cells treated with aqueous and ethanol VC extracts with the same VC concentration at 50 μg/ml. The same result was found with higher antioxidant capability of ethanol extract (Figure 3). Figures 2 and 3 show the antioxidant power of cytoplasmic content of SW620 and HT29 in time.

Figure 3.

Figure 3

Open in a new tab

% Inhibition of ABTS Radical of Cell Lysates in SW620 and HT29 Grown in Aqueous and Ethanol VC Extracts for 1 and 4 Days at Concentration of 50 μg/ml. Data were expressed in mean ± SD of three independent experiments

Lipid peroxidation assay

TBARS assay is a simple, precise, sensitive, and reproducible spectrophotometric method for quantitative MDA determination as a marker for lipid peroxidation. This method was used to determine MDA level in cytoplasmic content of human colorectal cancer cell lines, SW620, and HT29 when exposed to different concentrations of aqueous and ethanol VC extracts. Figure 4 shows a dose-dependent manner of MDA reduction in SW620 and HT29. The obvious point is the different concentrations of extracts so that aqueous extract concentrations are 8-fold higher than that of ethanol extract.

Figure 4.

Figure 4.

Open in a new tab

MDA Content from TBARS Assay of Cytoplasmic Content of Human Colorectal Cancer Cell Lines (SW620 and HT29) Grown in Aqueous and Ethanol VC Extracts for 4 Days. Data are expressed in mean ± SD of three independent experiments

Expression of antioxidant genes

Gene expression was assessed through quantitative real-time RT-PCR, normalized with GAPDH, and expressed as the mean score of fold change compared to control condition. The four antioxidant genes were down-regulated in human colorectal cancer cells ( SW620) then treated with aqueous and ethanol VC extracts for four days. In contrast, upregulation was obviously found in HT29 grown in aqueous VC extract for four days, while upregulation and downregulation were found in HT29 grown in ethanol VC extract.

Table 1.

Primers Used for Real–time PCR Amplification

Genes Primer sequence (5’ ® 3’) Product size (bp)
SOD Forward primer: GAGACTTGGGCAATGTGACTG 201
Reverse primer: TTACACCACAAGCCAAACGA
CAT Forward primer: CCTGGAGCACAGCATCCAAT 85
Reverse primer: GAATGCCCGCACCTGAGTAA
GPx Forward primer: TGGACATCAGGAGAACTGTCAGA 134
Reverse primer: AGACAGGATGCTCGTTCTGCC
GRx Forward primer: AAGCGGGATGCCTATGTGAG 107
Reverse primer: TTGGGATCACTCGTGAAGGC
GAPDH Forward primer: AGTCCACTGGCGTCTTCACC 119
Reverse primer: GTTCACACCCATGACGAACATG
Open in a new tab

Figure 5.

Figure 5

Open in a new tab

Down Regulation of Antioxidant Gene Expression in Human Colorectal Cancer Cells (SW620) Treated with Aqueous and Ethanol VC Extracts for 4 Days. Data are expressed in mean ± SD of three independent experiments

Figure 6.

Figure 6

Open in a new tab

Upregulation and Downregulation of Antioxidant Gene Expression in Human Colorectal Cancer Cells (HT29) Treated with Aqueous and Ethanol VC Extracts for 4 days. Data are expressed in mean ± SD of three independent experiments

Discussion

The safety and protective effect to normal cells and endothelial cells of aqueous VC extracts have been studied previously (Supabhol et al., 2013). This study showed a significantly higher IC50 of aqueous VC extract compared to that of ethanol VC extracts in both human colorectal cancer cell lines. It was found that extraction conducted using ethanol can extract compounds or ingredients containing more cytotoxic effects. This highlights the influence of solvent and extraction methods on the cytotoxic activity of VC extract. It is the reason why extracts may display differential cytotoxic effects depending on the extraction solvent. Ethanol is known as a good solvent for a number of compounds such as polyphenols. A key advantage of ethanol is that it is safe for human consumption (Kowalska et al., 2021; Traversier et al., 2020).

Cytoplasmic content of SW620 and HT29 were tested using DPPH and ABTS assays to investigate intracellular antioxidant capacity. These two assays are the most popular methods frequently used to detect the antioxidant capability of several plant extracts. DPPH assay was used to screen the antioxidant activity based on the reduction of the purple DPPH to yellow DPPH-H. DPPH is a radical dissolved in organic solvent, methanol or ethanol. Aqueous alcoholic system is normally used to keep this radical soluble. ABTS assay can be used to detect the ability of hydrophilic and lipophilic antioxidants to scavenge the blue/green cation ABTS generated and dissolved in aqueous and organic solvents (Munteanu and Apetrei C, 2021; Wołosiak et al., 2021). These two assays were used to detect the antioxidant property from lipophobic and hydrophobic molecules in cytoplasmic content of cells grown in culture media with aqueous and ethanol VC extracts. The cytoplasmic content from cells grown in ethanol VC extract expressed a higher antioxidant capability than that in aqueous VC extract. This is consistent with dose- and time-dependent manner of intracellular MDA reduction in Figure 4 when SW620 and HT29 are cultured in aqueous or ethanol VC extracts. Free radicals were the causes of lipid peroxidation and involved in damaging mechanisms of several diseases. MDA is one of the end products in lipid peroxidation and its overproduction is considered as a biomarker of oxidative stress (Tsikas, 2017). Thus, aqueous and ethanol VC extracts may have the ability to scavenge free radicals in both SW620 and HT29. Antioxidant modulation has a higher chance to participate in this cellular event. It is reported that VC extract possesses antioxidant and antimicrobial activities (Rajamurugan et al., 2011; Sonibare et al., 2016). This shows the protective activity in 2,2’-azobis(2-amidinopropane) dihydrochloride (AAPH)-treated blood via the inhibition of MDA formation (Ketsuwan et al., 2017) and reduction of lipid peroxide in blood and liver of mice in carrageenan induced paw edema model (Kumar and Kuttan, 2009).

The possibility of modulating effect through the intracellular antioxidative system was further investigated using gene expression of antioxidant enzymes, SOD, CAT, GPx and GRx. These are the key enzymatic antioxidants to scavenge or deactivate free radicals before cellular components are attacked. In carrageenan induced paw edema mice, VC extract can significantly increase the levels of CAT, SOD, GPx and glutathione-S transferase in blood and liver (Kumar and Kuttan, 2009). Lupeol isolated from VC was found effective in treating cataract formation in Sprague Dawley rats via these antioxidant enzymes (Asha et al., 2016). Enhancing these antioxidant enzymes plays an important role in the protective effect of VC against oxidative stress from gamma radiation in mice (Pratheeshkumar and Kuttan, 2011b). In this study, both aqueous and ethanol VC extracts seemed to reduce gene expression of these four antioxidant enzymes in SW620. Gene expression of antioxidant enzymes in HT29 did not show the same pattern found in SW620. VC extracts may not function in the same pattern in different colorectal cancer cells. However our result showed the effect of VC extracts via the interference of antioxidative balance. Four antioxidative enzymes were changed after VC extract treatment.

In conclusions, VC-EtOH extract exhibited cytotoxicity to both colorectal cancer cell lines. Sesquiterpene lactone, especially vernolide-A, might be one of the bioactive compounds against cancer cells which is better extracted by ethanol. VC extracts were capable of changing the oxidative-antioxidative balance via MDA production or free radical neutralization. This led to the alteration of antioxidative power inside the cancer cells. Suitable concentrations of VC-EtOH extract (25-50 μg/mL) can be used in the future in vivo studies and pharmaceutical development. Protein expression of antioxidant enzymes, i.e. catalase, superoxide dismutase, glutathione peroxidase and glutathione reductase should be further investigated for the explanation of VC in cellular mechanisms.

Author Contribution Statement

R Supabphol was responsible for the overall experimental design and supervision of the experiments and preparation of the final article. W. Yahayo performed most of the experiments and data analysis. J Pakpisutkul, J Suwapraphan, N Sripayak, N Sitkhuntod and S Loyrat helped for experimental design and performed part of the experiments.

Acknowledgements

This study is financially supported by a grant from HRH Princess Maha Chakri Sirindhorn Medical Center (MSMC), Faculty of Medicine, Srinakharinwirot University,Thailand (154/2564 and 155/2564).

Conflicts of Interest

The authors do not have anything to declare and have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this article.

References

  1. Akimoto N, Ugai T, Zhong R, et al. Rising incidence of early-onset colorectal cancer - a call to action. Nat Rev Clin Oncol. 2021;18:230–43. doi: 10.1038/s41571-020-00445-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amuthan A, Devi V, Shreedhara CS, et al. Vernonia cinerea regenerates tubular epithelial cells in cisplatin induced nephrotoxicity in cancer bearing mice without affecting antitumor activity. J Tradit Complement Med. 2020;11:279–86. doi: 10.1016/j.jtcme.2020.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Appadath Beeran A, Maliyakkal N, Rao CM, et al. The enriched fraction of Vernonia cinerea induces apoptosis and inhibits multi-drug resistance transporters in human epithelial cancer cells. J Ethnopharmacol. 2014;158:33–42. doi: 10.1016/j.jep.2014.10.010. [DOI] [PubMed] [Google Scholar]
  4. Asha R, Gayathri Devi V, Abraham A. Lupeol, a pentacyclic triterpenoid isolated from Vernonia cinerea attenuate selenite induced cataract formation in Sprague Dawley rat pups. Chem Biol Interact. 2016;245:20–9. doi: 10.1016/j.cbi.2015.12.002. [DOI] [PubMed] [Google Scholar]
  5. Beeran AA, Udupa N, Maliyakkal N. The dichloromethane fraction of Vernonia cinerea impart pro-apoptotic, genotoxic, cell cycle arrest, and drug efflux inhibitory effects on human adenocarcinoma cells. Recent Pat Anticancer Drug Discov. 2020;15:239–56. doi: 10.2174/1574892815999200824122723. [DOI] [PubMed] [Google Scholar]
  6. Boakye D, Jansen L, Schöttker B, et al. Blood markers of oxidative stress are strongly associated with poorer prognosis in colorectal cancer patients. Int J Cancer. 2020;147:2373–86. doi: 10.1002/ijc.33018. [DOI] [PubMed] [Google Scholar]
  7. Cao Y, Deng S, Yan L, et al. An oxidative stress index-based Score for prognostic prediction in colorectal cancer patients undergoing surgery. Oxid Med Cell Longev. 2021;2021:6693707. doi: 10.1155/2021/6693707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Catalano T, D’Amico E, Moscatello C, et al. Oxidative distress induces Wnt/beta-catenin pathway modulation in colorectal cancer cells: Perspectives on APC retained functions. Cancers (Basel) 2021;13:6045. doi: 10.3390/cancers13236045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chok KC, Koh RY, Ng MG, et al. Melatonin induces autophagy via reactive oxygen species-mediated endoplasmic reticulum stress pathway in colorectal cancer cells. Molecules. 2021;26:5038. doi: 10.3390/molecules26165038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cruz BCDS, de Sousa Moraes LF, De Nadai Marcon L, et al. Evaluation of the efficacy of probiotic VSL#3 and synbiotic VSL#3 and yacon-based product in reducing oxidative stress and intestinal permeability in mice induced to colorectal carcinogenesis. J Food Sci. 2021;86:1448–62. doi: 10.1111/1750-3841.15690. [DOI] [PubMed] [Google Scholar]
  11. Dogra NK, Kumar S. A review on ethno-medicinal uses and pharmacology of Vernonia cinerea Less. Nat Prod Res. 2014;29:1102–17. doi: 10.1080/14786419.2014.981814. [DOI] [PubMed] [Google Scholar]
  12. Ketsuwan N, Leelarungrayub J, Kothan S, Singhatong S. Antioxidant compounds and activities of the stem, flower, and leaf extracts of the anti-smoking Thai medicinal plant: Vernonia cinerea Less. Drug Des Devel Ther. 2017;11:383–91. doi: 10.2147/DDDT.S126882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Khay M, Toeng P, Mahiou-Leddet V, et al. HPLC analysis and cytotoxic activity of Vernonia cinerea. Nat Prod Commun. 2012;7:1259–62. [PubMed] [Google Scholar]
  14. Kowalska G, Baj T, Kowalski R, et al. Optimization of glycerol-water extraction of selected hioactive compounds from peppermint and common nettle. Antioxidants (Basel) 2021;10:817. doi: 10.3390/antiox10050817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Koyuncu İ, Gönel A, Temiz E, et al. Pistachio green hull extract induces apoptosis through multiple signaling pathways by causing oxidative stress on colon cancer cells. Anticancer Agents Med Chem. 2021;21:725–37. doi: 10.2174/1871520620999200730155524. [DOI] [PubMed] [Google Scholar]
  16. Kumar PP, Kuttan G. Vernonia cinerea scavenges free radicals and regulates nitric oxide and proinflammatory cytokines profile in carrageenan induced paw edema model. Immunopharmacol Immunotoxicol. 2009;31:94–102. doi: 10.1080/08923970802438391. [DOI] [PubMed] [Google Scholar]
  17. Lau MF, Chua KH, Sabaratnam V, et al. In vitro anti-colorectal cancer potential of the medicinal mushroom ganoderma neo-japonicum imazeki in hyperglycemic condition: impact on oxidative stress, cell cycle and apoptosis. Nutr Cancer. 2021;4:1–18. doi: 10.1080/01635581.2021.1931701. [DOI] [PubMed] [Google Scholar]
  18. Maiti P, Nand M, Joshi T, et al. Identification of luteolin -7-glucoside and epicatechin gallate from Vernonia cinerea, as novel EGFR L858R kinase inhibitors against lung cancer: Docking and simulation-based study. J Biomol Struct Dyn. 2021;39:5048–57. doi: 10.1080/07391102.2020.1784791. [DOI] [PubMed] [Google Scholar]
  19. Munteanu IG, Apetrei C. Analytical methods used in determining antioxidant activity: A Review. Int J Mol Sci. 2021;22:3380. doi: 10.3390/ijms22073380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Pouyfung P, Choonate S, Wongnoppavich A, et al. Anti-proliferative effect of 8 alpha-tigloyloxyhirsutinolide-13-O-acetate (8alphaTGH) isolated from Vernonia cinerea on oral squamous cell carcinoma through inhibition of STAT3 and STAT2 phosphorylation. Phytomedicine. 2019;52:238–46. doi: 10.1016/j.phymed.2018.09.211. [DOI] [PubMed] [Google Scholar]
  21. Pratheeshkumar P, Kuttan G. Ameliorative action of Vernonia cinerea L on cyclophosphamide-induced immunosuppression and oxidative stress in mice. Inflammopharmacol. 2010;18:197–207. doi: 10.1007/s10787-010-0042-8. [DOI] [PubMed] [Google Scholar]
  22. Pratheeshkumar P, Kuttan G. Vernonia cinerea Less inhibits tumor cell invasion and pulmonary metastasis in C57BL/6 mice. Integr Cancer Ther. 2011a;10:178–91. doi: 10.1177/1534735410384861. [DOI] [PubMed] [Google Scholar]
  23. Pratheeshkumar P, Kuttan G. Protective role of Vernonia cinerea against gamma radiation-induced immunosupression and oxidative stress in mice. Hum Exp Toxicol. 2011b;30:1022–38. doi: 10.1177/0960327110385959. [DOI] [PubMed] [Google Scholar]
  24. Pratheeshkumar P, Kuttan G. Effect of vernolide-A, a sesquiterpene lactone from Vernonia cinerea L on cell-mediated immune response in B16F-10 metastatic melanoma-bearing mice. Immunopharmacol Immunotoxicol. 2011c;33:533–8. doi: 10.3109/08923973.2010.547501. [DOI] [PubMed] [Google Scholar]
  25. Pratheeshkumar P, Kuttan G. Vernolide-A, a sesquiterpene lactone from Vernonia cinerea, induces apoptosis in B16F-10 melanoma cells by modulating p53 and caspase-3 gene expressions and regulating NF-kappaB-mediated bcl-2 activation. Drug Chem Toxicol. 2011d;34:261–70. doi: 10.3109/01480545.2010.520017. [DOI] [PubMed] [Google Scholar]
  26. Pratheeshkumar P, Kuttan G. Antimetastatic potential of vernolide-A, a sesquiterpenoid from Vernonia cinerea L. Hum Exp Toxicol. 2012;31:66–80. doi: 10.1177/0960327111414279. [DOI] [PubMed] [Google Scholar]
  27. Puttarak P, Pornpanyanukul P, Meetam T, et al. Efficacy and safety of Vernonia cinerea (L ) Less for smoking cessation: A systematic review and meta-analysis of randomized controlled trials. Complement Ther Med. 2018;37:37–42. doi: 10.1016/j.ctim.2018.01.009. [DOI] [PubMed] [Google Scholar]
  28. Rajamurugan R, Selvaganabathy N, Kumaravel S, et al. Identification, quantification of bioactive constituents, evaluation of antioxidant and in vivo acute toxicity property from the methanol extract of Vernonia cinerea leaf extract. Pharm Biol. 2011;49:1311–20. doi: 10.3109/13880209.2011.604334. [DOI] [PubMed] [Google Scholar]
  29. Sonibare MA, Aremu OT, Okorie PN. Antioxidant and antimicrobial activities of solvent fractions of Vernonia cinerea ( ) Less leaf extract. Afr Health Sci. 2016;16:629–39. doi: 10.4314/ahs.v16i2.34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Supabphol R, Wattanachaiyingcharoen R, Kamkaen N, et al. Cytoprotective effect of Vernonia cinerea Less extract on human umbilical vein endothelial cells against nicotine toxicity. J Med Plant Res. 2013;7:980–7. [Google Scholar]
  31. Supabphol R, Wattanachaiyingcharoen R, Kamkaen N, Supabphol A. Cytoprotective effect of Vernonia cinerea Les extract on human umbilical vein endothelial cells against nicotine toxicity. J Med Plant Res. 2013;7:980–7. [Google Scholar]
  32. Toyang NJ, Verpoorte R. A review of the medicinal potentials of plants of the genus Vernonia (Asteraceae) J Ethnopharmacol. 2013;146:681–723. doi: 10.1016/j.jep.2013.01.040. [DOI] [PubMed] [Google Scholar]
  33. Traversier M, Gaslonde T, Lecso M, et al. Comparison of extraction methods for chemical composition, antibacterial, depigmenting and antioxidant activities of Eryngium maritimum. Int J Cosmet Sci. 2020;42:127–35. doi: 10.1111/ics.12595. [DOI] [PubMed] [Google Scholar]
  34. Tsikas D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal Biochem. 2017;524:13–30. doi: 10.1016/j.ab.2016.10.021. [DOI] [PubMed] [Google Scholar]
  35. Vecchiotti G, Colafarina S, Aloisi M, et al. Genotoxicity and oxidative stress induction by polystyrene nanoparticles in the colorectal cancer cell line HCT116. PLoS One. 2021;16:e0255120. doi: 10.1371/journal.pone.0255120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Vernia F, Longo S, Stefanelli G, et al. Dietary factors modulating colorectal carcinogenesis. Nutrients. 2021;13:143. doi: 10.3390/nu13010143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wang S, Wang X, Wang YU, et al. The anti-oxidant monoterpene p-cymene reduced the occurrence of colorectal cancer in a hyperlipidemia rat model by reducing oxidative stress and expression of inflammatory cytokines. Anticancer Res. 2021;41:1213–8. doi: 10.21873/anticanres.14878. [DOI] [PubMed] [Google Scholar]
  38. Wołosiak R, Drużyńska B, Derewiaka D, et al. Verification of the conditions for determination of antioxidant activity by ABTS and DPPH assays-A practical approach. Molecules. 2021;27:50. doi: 10.3390/molecules27010050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yahayo W, Supabphol A, Supabphol R. The in vitro metastatic suppression of Phyllanthus emblica extract on human fibrosarcoma cells. Asian Pac J Cancer Prev. 2013;14:6863–7. doi: 10.7314/apjcp.2013.14.11.6863. [DOI] [PubMed] [Google Scholar]
  40. Zhang M, Yang X, Wei Y, et al. Bioactive sesquiterpene lactones isolated from the whole plants of Vernonia cinerea. J Nat Prod. 2019;82:2124–31. doi: 10.1021/acs.jnatprod.8b01078. [DOI] [PubMed] [Google Scholar]
  41. Zińczuk J, Maciejczyk M, Zaręba K, et al. Antioxidant barrier, redox status, and oxidative damage to biomolecules in patients with colorectal cancer Can malondialdehyde and catalase be markers of colorectal cancer advancement? Biomolecules. 2019;9:637. doi: 10.3390/biom9100637. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Asian Pacific Journal of Cancer Prevention : APJCP are provided here courtesy of West Asia Organization for Cancer Prevention

RESOURCES