Table 1:
Locations of binding peaks from ChIP-seq experiments
| peak centre | gene(s)4 | site location | site sequence | TSS5 |
|---|---|---|---|---|
| HapR ChIP-seq peaks | ||||
| chromosome I | ||||
|
| ||||
| 99874 | VC0102<(VC0103) | 99863.5 | aaattaataaaactgtcattta | 99906(+) |
| 213457 | (VC0205)>VC0206 | 213452.5 | taattgtgattcttatcaccaa | 213494 (+) |
| 2463661 | VC0240<>VC0241 | 246349.5 | taattaagatggctataaacta | 246430 (−) |
| 463584 | VC0433 | |||
| 514422 | VC0484 | 514430.5 | ctactgaccttttcatcaataa | 514427 (+) |
| 516570 | (VC0486) | 516601.5 | caactgagaaggcacacaatag | 516545 (+) |
| 534714 | (VC0502) | 534691.5 | ctattataagctctatcagtgt | 534805 (−) |
| 547108 | VC0515 | 547135.5 | atagtaatattattgttaatag | 549431 (−) |
| 6133283 | VC0583 A | 613357.5 | ttattgagtgggtacataacaa | 613427 (+) |
| 716707 | VC0668 | 716625.5 | ctattgatgaggttatccacag | 716537 (−) |
| 735309 | VC0687<>VC0688 | |||
| 882854 | (VC0822) | 882825.5 | taattatccactttatcaattg | 883072 (−) |
| 941187 | VC0880 | 941164.5 | cttttgacatttctgtcacaaa | 941152 (+) |
| 978577 | VC0916 R | 978540.5 | taattaatatccagctcaatta | 978581 (+) |
| 1356743 | VC1280<>VC1281 A | 1356736.5 | atattgatagaaataacaagtc | 1356896 (+) |
| 1379202 | VC1298<>VC1299 | 1379180.5 | ttcatgatagttttgtaattat | 1379189 (+) |
| 1469384 | VC1375<>VC1376 | 1469377.5 | atattgatatatcacacatctt | 1469374 (+) |
| 1496023 | VC1403 A <>VC1405 | 1496025.5 | tagttgatatttttataattgt | 1495942 (+) |
| 1533842 | (VC1437) | 1533854.5 | tttgtgagtctcctgtcaataa | 1533703 (−) |
| 19901332 | VC1851 | 1990076.5 | atattgagtaatcaattagtaa | 1990031(+) |
| 2364721 | (VC2212) | 2364680.5 | ctattaacagttttatttataa | 2364774 (+) |
| 2509878 | VC2352 | 2509882.5 | ttagtgacagatgcgtcattaa | 2509790 (−) |
| 2667349 | VC2486 | 2667368.5 | taattattaatttgaacaatag | 2667206 (−) |
| chromosome II | ||||
|
| ||||
| 1638081 | VCA0148 | 163810.5 | taattgattattgtgtaactat | 163852 (−) |
| 214589 | (VCA0198) | 214582.5 | taattgataactttgacagtat | 213494 (+) |
| 237008 | VCA0218<>VCA0219 R | 237019.5 | taaataatatgaatatcagtaa | 237053 (+) |
| 247286 | VCA0224<>VCA0225 | 247241.5 | taaatgactaataagacaatta | 247165 (−) |
| 598444 | VCA 0662<>VCA0663 R | 598403.5 | tttgtaataaatttgtcattaa | 598413 (+) |
| 630517 | VCA0691 A, | 630559.5 | ctattaacaggactgacattaa | 631303 (+) |
| 862737 | VCA0906 | |||
| 910196 | VCA0960 R <>VCA0961 | 910181.5 | ctgattataaatttgtaaatat | 910330 (+) |
| 1021174 | VCA1070 | 1021117.5 | ctcctatccgattggtcactat | 1021326 (+) |
| LuxO ChIP-seq peaks | ||||
| chromosome I | ||||
|
| ||||
| 1090129 | qrr1<> VC1021 | 1090154 | ttgcaaaatgcaa | 1090182 (+) |
| 1212442 | VC1142<>VC1143 | 1212435 | ttgcaaatcgcga | 1212403 (−) |
| chromosome II | ||||
|
| ||||
| 48415 | qrr2 | 48347 | ttgcaatttgcaa | 48851 (−) |
| 772208 | qrr3 | 772149 | ttgcattttgcaa | 772227 (+) |
| 908445 | qrr4 | 908436 | ttgcaatttgcaa | 908475 (+) |
Identified by Tsou and co-worlers28
Identified by Waters and co-workers29
Identified by Lin and co-workers27
Identified as activated (A) or repressed (R) by Nielsen and co-workers23, VC0206, VC0240, VC0241, VC0583, VC0668, VC0916, VC1021, VC1142, VC1143, VCA0219 correspond to murQ, rfaD, rfbA, hapR, mutH, vpsU, luxO, cspD, clpS, hlyA respectively.
Nearest transcription start site (TSS) identified by Papenfort et al.32 with the symbol in parenthesis indicating the direction of transcription. Note that these are not necessarily those TSSs subject to regulation by HarR or LuxO, particularly if the regulators are acting as repressors, or if the gene subject to regulation is switched off for another reason in the conditions of Papenfort et al.