Skip to main content
. 2023 Jan 31;12:e83486. doi: 10.7554/eLife.83486

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus) C57BL/6J The Jackson Laboratory RRID:IMSR_JAX:000664
Strain, strain background (M. musculus) B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J The Jackson Laboratory RRID:IMSR_JAX:007909
Strain, strain background (M. musculus) B6.Cg-Tg(Pdgfrb-cre/ERT2)6096Rha/J The Jackson Laboratory RRID:IMSR_JAX:029684
Strain, strain background (M. musculus) C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J The Jackson Laboratory RRID:IMSR_JAX:007900
Strain, strain background (M. musculus) Tg(Cspg4-DsRed.T1)1Akik/J The Jackson Laboratory RRID:IMSR_JAX:008241
Antibody anti-Desmin [Y66] (Rabbit monoclonal) Abcam Cat#: ab32362 1:50
Antibody anti-β-III Tubulin [EP1569Y] (Rabbit monoclonal) Abcam Cat#: ab52623 1:200
Antibody anti-CD31 [MEC 7.46] (Rat monoclonal) Abcam Cat#: ab7388 1:100
Antibody anti-VEGFR2 [EPR21884-236] (Rabbit monoclonal) Abcam Cat#: ab233693 1:500
Antibody anti-VEGFA (Rabbit polyclonal) Abcam Cat#: ab51745 1:400
Antibody anti-PDGFRβ [Y92] (Rabbit monoclonal) Abcam Cat#: ab32570 1:1000-1:5000
Sequence-based reagent B6.Cg-Tg(Pdgfrb-cre/ERT2)6096Rha/J F The Jackson Laboratory PCR primers GAA CTG TCA CCG GGA GGA
Sequence-based reagent B6.Cg-Tg(Pdgfrb-cre/ERT2)6096Rha/J R The Jackson Laboratory PCR primers AGG CAA ATT TTG GTG TAC GG
Sequence-based reagent B6.Cg-Tg(Pdgfrb-cre/ERT2)6096Rha/J internal positive control F The Jackson Laboratory PCR primers CAA ATG TTG CTT GTC TGG TG
Sequence-based reagent B6.Cg-Tg(Pdgfrb-cre/ERT2)6096Rha/J internal positive control R The Jackson Laboratory PCR primers GTC AGT CGA GTG CAC AGT TT
Sequence-based reagent Mouse VEGFA F IDT PCR primers GCAGCGACAAGGCAGACTA
Sequence-based reagent Mouse VEGFA R IDT PCR primers GGTCCGATGCAAGATCCCAA
Peptide, recombinant protein Diphtheria toxin Sigma Cat#: D0564 10 ng/g body weight
Peptide, recombinant protein Dispase II Sigma Cat#: D4693
Peptide, recombinant protein Collagenase I ThermoFisher Cat#: 17018029
Peptide, recombinant protein DNase I Sigma Cat#: 10104159001
Peptide, recombinant protein 100× Penicillin-Streptomycin Solution Invitrogen/Gibco Cat#: 15140–122
Commercial assay or kit Invitrogen Total Exosome Isolation Reagent (from cell culture media) ThermoFisher Cat#: 4478359
Commercial assay or kit SuperSignal West Femto Duration Substrate Thermo Fisher Scientific Cat#: A38554
Commercial assay or kit Clontech SMARTer cDNA kit Clontech Laboratories Cat#: 634925
Commercial assay or kit NEBNext reagents New England Biolabs Cat#: E6040
Commercial assay or kit RNeasy micro kit Qiagen Cat#: 74004
Commercial assay or kit SuperScript IV First-Strand Synthesis kit ThermoFisher Cat#: 18091050
Commercial assay or kit VEGFA ELISA Kit Abcam Cat#: ab119565
Commercial assay or kit BCA protein assay kit Abcam Cat#: ab102536
Commercial assay or kit ExoGlow-Protein EV Labeling Kit (Green) SBI Cat#: EXOGP300A-1
Chemical compound and drug Tamoxifen Sigma Cat#: T5648 75 mg/kg body weight
Chemical compound and drug SU5408 Abcam Cat#: ab145888
Software and algorithm Sample Size Calculator N/A https://clincalc.com/stats/samplesize.aspx
Software and algorithm ImageJ NIH https://imagej.nih.gov/ij/
Software and algorithm PANTHER classification system N/A http://www.pantherdb.org/
Software and algorithm REVIGO Ruđer Bošković Institute http://revigo.irb.hr/
Other Lectin-DyLight 488 Vector Laboratories Cat#: DL-1174 20 μg/ml
Other Lectin-DyLight 649 Vector Laboratories Cat#: DL-1178 20 μg/ml
Other Decal Stat Decalcifier StatLab Cat#: 1212–32 Use directly (contains Hydrogen Chloride, Acid mists, strong inorganic)
Other Antifade Mounting Medium with DAPI Vector Laboratories Cat#: H-1200 Use directly (contains 1 μg/ml of DAPI)