| Antibodies |
|
| anti-gp12- outer domain 2G12 |
NIH Reagents program |
N/A |
| anti-CD4 binding site VRC03 |
NIH Reagents program |
Cat # 12032 |
| anti-CD4 binding site 3BNC117 |
Scheid et al.62
|
Cat #: 12474 |
| anti-V2 apex PG9 |
Polymum Scientific, Klosterneuburg, Austria |
N/A |
| anti-V3 10.1074 |
Dr. Michel Nussenzweig; Mouquet et al.63
|
N/A |
| anti-V3 PGT121 |
IAVI; Walker et al.64
|
Cat # 12343 |
| anti-gp120-gp41 interface PGT151 |
IAVI; Falkowska et al.46
|
N/A |
| anti-MPER 10e8 |
NIH Reagents program; Huang et al.47
|
Cat# 12294 |
| anti-gp41 DSR F240 |
NIH Reagents program; Cavacini et al.65
|
Cat# 7623 |
| anti-V3 crown 19b |
NIH Reagents program |
N/A |
| anti-coreceptor binding site 17b |
NIH Reagents program |
Cat # 4091 |
| anti-cluster A A32 |
NIH Reagents program |
Cat # 11438 |
| PE-conjugated anti-HIV p24 (Clone KC57-RD1) |
Beckman Coulter |
Cat# CO6604667 |
| FITC-conjugated anti-HIV-p24 (Clone KC57) |
Beckman Coulter |
Cat# 6604665 |
| BUV395 conjugated anti-CD3 (Clone UCHT1) |
BD Biosciences |
Cat# 563546 |
| BV650 conjugated anti-CD11b (Clone: M1/70) |
Biolegend |
Cat# 101239 |
| PE-Cy7 conjugated anti-BST2(Clone RS38E) |
Biolegend |
Cat# 348416 |
| BV421 conjugated anti-CD4 (Clone OKT4) |
Biolegend |
Cat# 317434 |
| BV650 conjugated anti-CD19 (CloneHIB19) |
Biolegend |
Cat# 302201 |
| FITC conjugated anti-CD16 (Clone 3G8) |
BD Pharmingen |
Cat # 555406 |
| PerCPCy5.5conjugate anti-CD14 (Clone M5E2) |
BD Pharmingen |
Cat # 550787 |
| PE conjugated anti-CD56 (Clone NCAM-1) |
BD Pharmingen |
Cat # 555516 |
|
| Bacterial and virus strains |
|
| HIV-1 AD8 (Proviral DNA) |
Theodore et al.66
|
Genbank Accession no. AF004394.1
|
| HIV-1 YU2 (Proviral DNA) |
Li et al.67
|
N/A |
| HIV-1 JRFL (Proviral DNA) |
Dr. Dennis Burton |
N/A |
| HIV-1 CH77 T/F (Proviral DNA) |
Ochsenbauer et al.68
|
N/A |
|
| Biological samples |
|
| Plasma from HIV-1-infected individuals |
FRQS AIDS network |
N/A |
| Human PBMC from uninfected individuals |
FRQS AIDS network |
N/A |
|
| Chemicals, peptides, and recombinant proteins |
|
| CD4mimetic BNM-III-170 |
Dr. Amos B. Smith III; Melillo et al.69
|
N/A |
| Dimethyl sulfoxide (DMSO) |
Thermo Fisher Scientific |
Cat# BP2311 |
| Phytohemagglutinin-L (PHA-L) |
Sigma |
Cat# L2769 |
| Dulbecco’s modified Eagle’s medium (DMEM) |
Wisent |
Cat# 319-005-CL |
| RPMI 1640 medium |
Thermo Fisher Scientific |
Cat#11875093 |
| Penicillin/streptomycin |
Wisent |
Cat# 450-201-EL |
| Fetal bovine serum (FBS) VWR Cat# 97068-085 |
VWR |
Cat# 97068-085 |
| Phosphate buffered saline (PBS) |
Wisent |
Cat# 311-010-CL |
| Tris-buffered saline (TBS) |
Thermo Fisher Scientific |
Cat# BP24711 |
| Bovine Serum Albumin (BSA) |
BioShop |
Cat# ALB001.100 |
| Formaldehyde-37% |
Thermo Fisher Scientific |
Cat# F79-500 |
| Cell proliferation dye eFluor670 |
eBioscience |
Cat# 65084085 |
| Cell proliferation dye eFluor450 |
eBioscience |
Cat# 65084285 |
| LIVE/DEAD Fixable AquaVivid Cell Stain |
Thermo Fisher Scientific |
Cat# L43957
|
| Tween 20 |
Thermo Fisher Scientific |
Cat# BP337-500 |
| Fc Blocking Reagent (human) |
Miltenyi |
Cat# 130-059-901 |
| Pooled human sera |
Valley Biomedicals |
HS1004C |
| Iscove’s modified Dulbecco medium (IMDM) |
Gibco-ThermoScientific |
Cat# 12440053 |
|
| Critical commercial assays |
|
| EasySep human CD4+ T cell enrichment kit |
Stem Cell Technologies |
Cat# 19052 |
| EasySep human NK cell isolation kit |
StemCell Technologies |
Cat# 17955 |
| EasySep human Monocyte enrichment kit |
StemCell Technologies |
Cat# 19059 |
| Cytofix/Cytoperm Fixation/Permeabilization Kit |
BD Biosciences |
Cat# 554714 |
| Mix-n-Stain CF-647 Antibody Labeling Kit (50–100μg) |
Sigma-Aldrich |
MX647S100-1KT |
| BD PhosFlow Perm/Wash Buffer I |
BD Biosciences |
Cat# 557885 |
| QuikChange II XL Site directed mutagenesis Kit |
Agilent Technologies |
Cat # 200522 |
|
| Experimental models: Cell lines |
|
| HEK293T human embryonic kidney cells |
ATCC |
CAT # CRL-3216 |
|
| Oligonucleotides |
|
| ENV-YU2-D368R-FWD:5′CCTCAGGAGGGCGACCAGAAATT GTAAC |
Integrated DNA Technologies (IDT) |
N/A |
| ENV-YU2-D368R-REV:5′GTTACAATTTCTGGTCGCCCTCC TGAGG |
Integrated DNA Technologies (IDT) |
N/A |
| ADAD368RFWD:CAATCCTCAGGAGGGCGCCCAGAAATTGTAATG |
Integrated DNA Technologies (IDT) |
N/A |
| ADAD368RREV:CATTACAATTTCTGGGCGCCCTCCTGAGGATTG |
Integrated DNA Technologies (IDT) |
N/A |
|
| Recombinant DNA |
|
| Plasmid: pAD8+ (IMC of HIV-1 AD8 WT) |
Theodore et al.66
|
GenBank accession no. AF004394.1
|
| HIV-1 AD8-Nef- (Proviral DNA) |
Dr. Frank Kirchoff |
N/A |
| HIV-1 AD8-Vpu- (Proviral DNA) |
Krapp et al.70
|
N/A |
| HIV-1 AD8-Nef-Vpu- (Proviral DNA) |
Dr. Frank Kirchoff |
N/A |
| HIV-1 AD8-D368R (Proviral DNA) |
This paper |
N/A |
| HIV-AD8-Nef-Vpu-D368R (Proviral DNA) |
This paper |
N/A |
| HIV-1 YU2-Nef- (Proviral DNA) |
This paper |
N/A |
| HIV-1 YU2-Vpu- (Proviral DNA) |
Dr. Frank Kirchoff |
N/A |
| HIV-1 YU2-Nef-Vpu- (Proviral DNA) |
Dr. Frank Kirchoff |
N/A |
| HIV-1 YU2-D368R (Proviral DNA) |
This paper |
N/A |
| HIV-YU2-Nef-Vpu-D368R (Proviral DNA) |
This paper |
N/A |
| HIV-1 JRFL-Nef- (Proviral DNA) |
Prévost et al.17
|
N/A |
| HIV-1 JRFL-Vpu- (Proviral DNA) |
Prévost et al.17
|
N/A |
| HIV-1 JRFL-Nef-Vpu- (Proviral DNA) |
Prévost et al.17
|
N/A |
| HIV-1 JRFL-D368R (Proviral DNA) |
Ding et al.71
|
N/A |
| HIV-JRFL-Nef-Vpu-D368R (Proviral DNA) |
This paper |
N/A |
| HIV-1 CH77 -Nef- (Proviral DNA) |
Prévost et al.17
|
N/A |
| HIV-1 CH77 -Vpu- (Proviral DNA) |
Kmiec et al.72
|
N/A |
| HIV-1 CH77 -Nef-Vpu- (Proviral DNA) |
Ding et la.23
|
N/A |
| HIV-1 CH77 -D368R (Proviral DNA) |
This paper |
N/A |
| HIV-CH77 -Nef-Vpu-D368R (Proviral DNA) |
This paper |
N/A |
| Vesicular Stomatitis virus G (VSV-G) plasmid |
Emi et al.73
|
N/A |
|
| Software and algorithms |
|
| FlowJo software v10.4 FlowJO, |
LLC http://docs.flowjo.com/vx/
|
N/A |
| Prism software Graphpad v9.3.0 |
https://www.graphpad.com/scientificsoftware/prism/
|
N/A |
| Adobe Illustrator Version 26.31 |
https://www.adobe.com/products/illustrator
|
N/A |
|
| Other |
|
| BD FORTESSA Flow Cytometer |
BD Biosciences |
N/A |
| Clear V-bottom 96 well plates (cell culture treated) |
Corning |
Cat #0877126 |
