Table 1.
Primer sequences of the genes analyzed by real-time PCR in hWJ-MSCs.
| Gene | Entrez Gene ID * | Left Primer | Right Primer | Bio-Rad Unique Assay ID | A.L. (bp) $ |
|---|---|---|---|---|---|
|
Glyceraldehyde 3-phosphate dehydrogenase
(GAPDH) |
2597 | - | - | qHsaCED0038674 | 117 |
|
TATA box binding protein
(TBP) |
6908 | - | - | qHsaCID0007122 | 120 |
|
Hypoxanthine phosphoribosyl transferase 1
(HPRT1) |
3251 | - | - | qHsaCID0016375 | 90 |
|
Tyrosine 3 monooxygenase/tryptophan 5-monooxygenase activation protein zeta
(YWHAZ) |
7534 | tcccgtttccgagccataaa | tgacctacgggctcctacaa | - | 233 |
|
Cyclin dependent kinase inhibitor 1A
(CDKN1A or p21) |
1026 | - | - | qHsaCID0014498 | 159 |
|
Cyclin dependent kinase inhibitor 2A
(CDKN2A or p16INK4α) |
1029 | - | - | qHsaCED0056722 | 86 |
|
Cyclin D1
(CCND1) |
595 | cagatcatccgcaaacacgc | aagttgttggggctcctcag | - | 143 |
| Octamer-binding transcription factor 4 (OCT-4 or POUF51A) | 5460 | - | - | qHsaCED0038334 | 100 |
|
Proliferation marker protein Ki-67
(MKI67) |
4288 | tcagactccatgtgcctgag | ttgtcctcagccttctttgg | - | 134 |
|
RUNX family transcription factor 2
(RUNX2) |
860 | ctccctgaactctgcaccaa | tagagtggatggacggggac | - | 149 |
|
Bone gamma-carboxyglutamic acid-containing protein (BGLAP or Osteocalcin) |
632 | caccgagacaccatgagagc | ctgcttggacacaaaggct | - | 132 |
|
Autophagy related 7
(ATG7) |
10533 | agcagctcatcgaaagccat | ttggcaaaaagcgatgagcc | - | 241 |
|
Microtubule associated protein 1 light chain 3 alpha
(MAP1LC3A or LC3A) |
84557 | ttggtcaagatcatccggcg | cctgggaggcgtagaccata | - | 163 |
|
Beclin 1
(BECN1) |
8678 | aaccagatgcgttatgccca | tccattccacgggaacactg | - | 148 |
* ID: identification number; $ A.L. (bp): Amplicon length (base pair).