Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer pairs for PCR amplification and DNA sequencing.
| S. No. | Gene name | Primer name | Primer sequence (5’- 3’) |
|---|---|---|---|
| 1 | Internal transcribed spacer 1 (ITS1) RNA gene primer pairs [10] | AITS Forward | CGGAAGTTCACCGATATTGC |
| AITS Reverse | AGGAAGCCAAGTCATCCATC | ||
| 2 | 18S ribosomal RNA gene primer pairs [9] | M18S-II-F-Tb (T. brucei gambiense) | CGTAGTTGAACTGTGGGCCACGT |
| M18S-II-R-Tb (T. brucei gambiense) | ATGCATGACATGCGTGAAAGTGAG |
PCR=Polymerase chain reaction, T. brucei=Trypanosoma brucei
