Skip to main content
. Author manuscript; available in PMC: 2024 Feb 16.
Published in final edited form as: Cell. 2023 Feb 6;186(4):864–876.e21. doi: 10.1016/j.cell.2022.12.041

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial and virus strains
P. aeruginosa ATCC 33351 WT ATCC NCBI: AWZD00000000.1
P. aeruginosa JD332 Jeremy R. Dettman Lab NCBI: LJNX01000000.1
P. aeruginosa BWH058 Deborah Hung Lab NCBI: JIES00000000.1
P. aeruginosa ATCC 27853 WT ATCC NCBI: CP015117.1
P. aeruginosa BWHPSA011 (Pa011) WT Deborah Hung Lab NCBI: NZ_AXQR00000000 .1
Pa011 ΔCBASS (Removal of 1250436–1254723bp; CapV, CdnA, Cap2, Cap3, DUF2188) This study N/A
Pa011 CapV (phospholipase) catalytic mutant S48A This study N/A
Pa011 CdnA (cyclase) catalytic mutant D87A/D89A This study N/A
Pa011 Cap 2 (E1/E2) catalytic mutant C450A/C453A This study N/A
Pa011 Cap3 (JAB) catalytic mutant E38A This study N/A
P. aeruginosa PAO1 (Pa) WT Joe Bondy-Denomy Lab NCBI: NC_002516.2
PaCBASS (PAO1 attTn7::Pa011 CBASS; CapV, CdnA, Cap2, Cap3, DUF2188) This study N/A
PaEV (Integration of mini-Tn7 empty vector) This study N/A
PaCBASS (JBD67 WT) lysogen This study N/A
PaCBASS (JBD67Δacb2) lysogen This study N/A
PaEV (JBD67 WT) lysogen This study N/A
PaEV (JBD67Δacb2) lysogen This study N/A
PahaCas3 (PAO1 attTn7::I-C CRISPR-Cas3 helicase attenuated (haCas3) system) This study N/A
PaCas13a (PAO1 attTn7::VI-A CRISPR-Ca13a system) Joe Bondy-Denomy Lab21 N/A
E. coli DH5α NEB Cat #C2987H
E. coli SM10 NEB Cat #C3019H
E. coli BL21 (DE3) Weidi Biotechnology Cat #EC1002
PaMx33 Gabriel Guarneros Peña Lab24 NCBI: KU884561
PaMx35 Gabriel Guarneros Peña Lab24 NCBI: KU884562
PaMx41 Gabriel Guarneros Peña Lab24 NCBI: KU884563
PaMx43 Gabriel Guarneros Peña Lab24 NCBI: KU884564
JBD18 Alan Davidson Lab57 NCBI: JX495041.1
JBD67 Alan Davidson Lab57 NCBI: NC_042135.1
JBD67Δacb2 #1 (Removal of 23005–23232bp orf34) This study N/A
JBD67Δacb21 #2 (Removal of 23047–23235bp orf34) This study N/A
JBD67Δacb2 #3 (Removal of 23066–23239bp orf34) This study N/A
D3 Alan Davison Lab58 NCBI: AF165214.2
PB-1 Alan Davison Lab59 NCBI: NC_011810
F8 Alan Davison Lab59 NCBI: NC_011703
14-1 Alan Davison Lab59 NCBI: NC_007810
Lind109 Alan Davison Lab N/A
Ab27 Christine Pourcel Lab60 NCBI: LN610579
Ab28 Christine Pourcel Lab60 NCBI: LN610589
PII10A Christine Pourcel Lab61 NCBI: LT594786
PhiKZ Alan Davison Lab62 NCBI: AF399011
PA3 Alan Davison Lab63 NCBI: HQ630627
Ab03 Christine Pourcel Lab60 NCBI: LN610573
Ab04 Christine Pourcel Lab60 NCBI: LN610581
Ab06 Christine Pourcel Lab60 NCBI: LN610582
Ab11 Christine Pourcel Lab60 NCBI: LN610583
Ab17 Christine Pourcel Lab60 NCBI: LN610576
M6 Peter Weigele64 NCBI: NC_007809
YuA Rob Lavigne Lab65 NCBI: NC_010116
Ab18 Christine Pourcel Lab60 NCBI: LN610577
Ab19 Christine Pourcel Lab60 NCBI: NC_042115
Ab20 Christine Pourcel Lab60 NCBI: LN610585
Ab21 Christine Pourcel Lab60 NCBI: NC_042115
PA5oct Rob Lavigne Lab66 NCBI: MK797984
PA-1 Peter Weigele64 NCBI: MN504636.1
DMS3 Alan Davison Lab57 NCBI: DQ631426.1
JBD25 Alan Davison Lab57 NCBI: JX495042.1
JBD30 Alan Davison Lab67 NCBI: NC_020198.1
Ab30 Christine Pourcel Lab60 NCBI: LN610590
JBD68 Alan Davison Lab68 NCBI: KY707339.1
LKD16 Rob Lavigne Lab69 NCBI: AM265638
LKD19 Rob Lavigne Lab70 NCBI: AM910651
KMV Rob Lavigne Lab71 NCBI: AJ505558
Ab05 Christine Pourcel Lab60 NCBI: LN610574
Ab12 Christine Pourcel Lab60 NCBI: NC_047967
LUZ7 Rob Lavigne Lab72 NCBI: NC_013691.1
Lit1 Rob Lavigne Lab72 NCBI: NC_013692.1
Ab09 Christine Pourcel Lab60 NCBI: HG962375
P3P1 Christine Pourcel Lab61 NCBI: LT594787
Ab22 Christine Pourcel Lab60 NCBI: LN610578
Chemicals, peptides, and recombinant proteins
HEPES sodium salt Sigma-Aldrich CAS: 7365-45-9
Cat #V900477-500G
Tris base Sigma-Aldrich CAS: 77-86-1
Cat #RDD008-2.5KG
Sodium dihydrogen phosphate dihydrate Sigma-Aldrich CAS: 13472-35-0
Cat #1063420250
Disodium hydrogen phosphate dodecahydrate Sigma-Aldrich CAS: 10039-32-4
Cat #1065790500
Bis-Tris propane Sigma-Aldrich CAS: 64431-96-5
Cat #B6755-25G
Sodium bromide Sigma-Aldrich CAS: 7647-15-6
Cat #310506-100G
PEG 3350 Biorigin CAS: 25322-68-3
Cat #BN33640
Ethylene glycol Sigma-Aldrich CAS: 107-21-1
Cat #102466
Glycerol Sigma-Aldrich CAS: 56-81-5
Cat#V900122-500ML
Imidazole Sigma-Aldrich CAS: 288-32-4
Cat #V900153-500G
Resorufin butyrate CHEMEGEN CAS: 15585-42-9
Cat #CY17497
Phenol:chloroform:isoamyl alcohol 25:24:1 Sigma-Aldrich CAS: 108-95-2; 6766-3; 123-51-3
Cat #P3803
Chloroform Sigma-Aldrich CAS: 67-66-3
Cat #C2432
Lysozyme Sigma-Aldric CAS: 12650-88-3
Cat #L6876
2X Phanta Max Master Mix Vazyme Cat #P515-03
2X Rapid Taq Master Mix Vazyme Cat #P222-AA
Gibson Assembly HiFi DNA Master Mix NEB Cat #E2621
KOD-Plus-Neo TOYOBO Cat #KOD-401
DpnI NEB Cat #R0176s
SacI NEB Cat #R3156S
PstI NEB Cat #R3140S
HindIII NEB Cat #R3104S
BamHI NEB Cat #R3136S
Proteinase K NEB Cat #P8107S
RNaseA Omega Bio-TEK Cat #AC118
High Affinity Ni-NTA Resin GenScript Cat #L00250-100
Pa011 CdnA recombinant protein This study N/A
Pa011 CapV recombinant protein This study N/A
Pa011 Cap2 (E1/E2) recombinant protein This study N/A
Pa011 Cap2C105A/C479A recombinant protein This study N/A
P1011 CdnA-Cap2C105A/C479A recombinant protein This study N/A
PaMx33 Acb2 WT recombinant protein This study N/A
PaMx33 Acb2Y11A recombinant protein This study N/A
PaMx33 Acb2K26A recombinant protein This study N/A
Critical commercial assays
DNA Clean & Concentrator Kit Zymo Research Cat #D4034
Gel DNA Recovery Kit Zymo Research Cat #D4008
Plasmid Miniprep Kit Zymo Research Cat #ZD4037
Qubit 1X dsDNA High Sensitivity Assay Kit ThermoFisher Cat #Q33231
Illumina DNA Prep Kit Illumina Cat #20015825
Illumina Miseq v3 Reagents Illumia Cat #15043894
Plasmid Miniprep Kit Vazyme Cat #DC201-01
Gel DNA Extraction Mini Kit Vazyme Cat #DC301-01
LFS Crystallization Screen Kit Molecular Dimensions Cat #MD1-121
3’,3’ cyclic GAMP ELISA Kit Arbor Assays Cat #K073-H1
Deposited data
Structure of Acb2 This study PDB: 8H2X
Structure of Acb2 bound with 3’,3’-cGAMP This study PDB: 8H2J
Structure of Acb2 bound with c-di-AMP This study PDB: 8H39
Oligonucleotides
PaMx41 orf11 crRNA guide #4: gatacgaccagtctgacgcttgac This study N/A
PaMx41 orf11 crRNA guide #5: tctgacgcttgacggtaagattga This study N/A
JBD67 orf34 crRNA guide #3: tctgacgcttgacggtaagattga This study N/A
JBD67 orf34 crRNA guide #4: ctggctgcagagccgttgcgctgggctgcgatcg This study N/A
3’,3’-cGAMP Sigma-Aldrich CAS: 849214-04-6
Cat #SML1232-5UMO
2’,3’-cGAMP Sigma-Aldrich CAS:1441190-66-4
Cat #SML1229-5UMO
c-di-GMP Sigma-Aldrich CAS: 61093-23-0
Cat #SML1228-1UMO
c-di-AMP Sigma-Aldrich CAS: 54447-84-6
Cat #SML1231-1UMO
3’,3’-c-UMP-GMP Biolog Life Science Institute CAS: 232933-52-7
Cat #C371
3’,3’-c-di-UMP Biolog Life Science Institute CAS: 73120-97-5
Cat #C256
3’,3’-c-UMP-AMP Biolog Life Science Institute CAS: 83799-66-0
Cat #C357
Recombinant DNA
pHERD30T (p30T) 39 N/A
p30T-Pa011 CBASS This study N/A
p30T-PaMx41-short orf24-v1 (37 a.a. with stop codon) This study N/A
p30T-PaMx41-short orf24-v2 (94 a.a. with stop codon) This study N/A
p30T-PaMx41-long orf24 (acb2) This study N/A
p30T-HDR-Acb2-AcrVIA1 This study N/A
p30T-crRNA-4-PaMx41-orf11 This study N/A
p30T-crRNA-5-PaMx41-orf11 This study N/A
p30T-crRNA-3-JBD67-orf34 This study N/A
p30T-crRNA-4-JBD67-orf34 This study N/A
pUC18-mini-Tn7T-LAC (pTn7) 40 N/A
pTn7-Pa011 CBASS This study N/A
pTNS3 41 N/A
pMQ30 42 N/A
pMQ30-HDR-Pa011-CapV-S48A This study N/A
pMQ30-HDR-Pa011-CdnA-D87A-D89A This study N/A
pMQ30-HDR-Pa011-E1-E2-C450A-C453A This study N/A
pMQ30-HDR-Pa011-JAB-E38A This study N/A
p30T-PaMx41-orf11-HDR-1-WT This study N/A
p30T-PaMx41-orf11-HDR-2-WT This study N/A
p30T-PaMx41-orf11-I121S This study N/A
p30T-PaMx41-orf11-I121T This study N/A
p30T-PaMx41-orf11-S330P This study N/A
p30T-PaMx41-Acb2-Y11A This study N/A
p30T-PaMx41-Acb2-K26A This study N/A
pET28a- His6-SUMO-Acb2 This study N/A
pET28a- His6-SUMO-Acb2-Y11A This study N/A
pET28a- His6-SUMO-Acb2-K26A This study N/A
pET28a-His6-CapV This study N/A
pET28a-His6-CdnA This study N/A
pET28a-His6-Cap2 E1/E2 This study N/A
pET28a- His6-Cap2 E1/E2-C105A/C479A This study N/A
pRSFDuet- His6-CdnA-Cap2 E1/E2-C105A/C479A This study N/A
Software and algorithms
National Center for Biotechnology Information (NCBI) database 36 https://blast.ncbi.nlmnih.gov/
Integrated Microbial Genomes (IMG) database 37 https://img.jgi.doe.gov/
DefenseFinder 34,38 https://defensefinder.mdmparislab.com/
Multiple Sequence Comparison by Log-Expectation (MUSCLE) 73 https://www.ebi.ac.uk/Tools/msa/muscle/
NCBI Multiple Sequence Alignment Viewer (MSA) MSA Software https://www.ncbi.nlm.nih.gov/tools/msaviewer/
NCBI Constraint-based Multiple Alignment Tool (COBALT) 50 https://www.ncbi.nlm.nih.gov/tools/cobalt/re_cobalt.cgi
Interactive Tree of Life (iTOL) 52 https://itol.embl.de/
MMSeqs2 74 https://github.com/soedinglab/mmseqs2
Cutadapt 45 https://cutadapt.readthedocs.io/en/stable/#
Bowtie2 46 https://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Integrative Genomics Viewer (IGV) 47 https://software.broadinstitute.org/software/igv/
SeqDiff SeqDiff GitHub Program https://github.com/hansenlo/SeqDiff
HHpred 75 https://toolkit.tuebingen.mpg.de/tools/hhpred
AlphaFold2 53 https://alphafold.ebi.ac.uk/
DALI 23 http://ekhidna2.biocenter.helsinki.fi/dali/
HKL2000 54 http://www.hkl-raycom/
PHENIX 56 http://www.phenixonline.org
COOT 55 http://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot
PyMOL The PyMOL Molecular Graphics System, Version 2.5.2., Schrodinger, LLC https://pymol.org/2/
OriginPro 8 OriginPro Software N/A
GraphPad Prism 9 GraphPad Software https://www.graphpad.com/
Other
Amicon Ultra-0.5 centrifugal filter unit Merck Cat #UFC500396
Lysing Matrix B beads MP Cat #6911100
Amicon concentrators (3 K) Millipore Cat #UFC800308
Amicon concentrators (10 K) Millipore Cat #UFC901096
Amicon concentrators (30 K) Millipore Cat #UFC903024
HisTrap FF (5 mL) GE Healthcare Cat #17-5255-01
HiTrap Heparin HP (5 mL) GE Healthcare Cat #17-0407-03
HiTrap Q Sepharose FF (5 mL) GE Healthcare Cat #17-5156-01
Superdex 200 increase 10/300 GL GE Healthcare Cat #17517501