Genetic screens reveal new targetable vulnerabilities in BAP1-deficient mesothelioma

. 2023 Jan 18;4(2):100915. doi: 10.1016/j.xcrm.2022.100915

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

BAP1 (D7W7O) Rabbit mAb	Cell Signaling Technology	Cat# 13271; RRID:AB_2798168
RAP1A (C-10) Mouse mAb	Santa Cruz Biotechnology	Cat# sc-373968; RRID:AB_10917062
Tri-Methyl-Histone H3 (Lys27) (C36B11) Rabbit mAb	Cell Signaling Technology	Cat# 9733, RRID:AB_2616029
a-Tubulin Mouse mAb	Sigma-Aldrich	Cat# T9026, RRID:AB_477593
Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, HRP	Thermo Fisher Scientific	Cat# G-21234, RRID:AB_2536530
Goat anti-Mouse IgG (H + L) Secondary Antibody, HRP	Thermo Fisher Scientific	Cat# 62-6520, RRID:AB_2533947

Bacterial and virus strains

Mouse Kinome CRISPR Knockout Library (Brie)	Doench et al.²¹	Addgene #75316
FH1-tUTG	Aubrey et al.⁴⁸	Addgene #70183
pLKO5.sgRNA.EFS.GFP	Heckl et al.⁴⁹	Addgene #57822

Chemicals, peptides, and recombinant proteins

Zoledronic Acid	Medkoo Biosciences	100950 CAS: 165800-06-6
GSK126	Selleck Chemicals	S7061 CAS: 1346574-57-9
Tazemetostat	Medkoo Biosciences	406265 CAS: 1403254-99-8
Lovastatin (MK-803)	Selleck Chemicals	S2061 CAS: 75330-75-5
Terbinafine HCl (KWD 201)	Selleck Chemicals	S2557 CAS: 78628-80-5

Critical commercial assays

ReliaPrep™ RNA Miniprep Systems	Promega	Cat# Z6012
Tetro cDNA synthesis kit	Meridian Bioscience	Cat# BIO-65043

Deposited data

RNA sequencing data	This paper	GSE222376
CRISPR/CAS9-screen MAGeCK results	This paper	Data available upon request
Patient survival and expression data (upon consent)	Genentech	EGAS00001001563
ChIP-seq data	This paper	GSE145022

Experimental models: Cell lines

Human: NCI-H226	Wellcome Trust Sanger Institute	RRID:CVCL_1544
Human: NCI-H226 + BAP1 WT	Wellcome Trust Sanger Institute	N/A
Human: NCI-H2452	Wellcome Trust Sanger Institute	RRID:CVCL_1553
Human: NCI-H2731	Wellcome Trust Sanger Institute	RRID:CVCL_U995
Human: NCI-H28	Wellcome Trust Sanger Institute	RRID:CVCL_1555
Human: NCI-H2804	Wellcome Trust Sanger Institute	RRID:CVCL_U998
Human: NCI-H2810	Wellcome Trust Sanger Institute	RRID:CVCL_U999
Human: NCI-H2818	Wellcome Trust Sanger Institute	RRID:CVCL_V000
Human: MSTO-211H	ATCC	RRID:CVCL_1430
Human: MPP-89	Wellcome Trust Sanger Institute	RRID:CVCL_1427
Human: MP38	Wellcome Trust Sanger Institute	RRID:CVCL_4D11
Human: MP41	Wellcome Trust Sanger Institute	RRID:CVCL_4D12
Human: MP46	Wellcome Trust Sanger Institute	RRID:CVCL_4D13
Human: Mel270	Wellcome Trust Sanger Institute	RRID:CVCL_C302
Human: MM28	Wellcome Trust Sanger Institute	RRID:CVCL_4D15
Human: MM66	Wellcome Trust Sanger Institute	RRID:CVCL_4D17
Human: OMM.1	Wellcome Trust Sanger Institute	RRID:CVCL_6939
Human: 92.1	Wellcome Trust Sanger Institute	RRID:CVCL_8607
Mouse: NC	Badhai et al.¹⁵	N/A
Mouse: BNC	Badhai et al.¹⁵	N/A
Mouse: BNCP	Badhai et al.¹⁵	N/A

Experimental models: Organisms/strains

Mouse: NOD-Scid IL2Rγnull	Jackson Laboratory	RRID:IMSR_JAX:005557
Mouse: Autochthonous Bap1-deficient mesothelioma model	Badhai et al.¹⁵	N/A

Oligonucleotides

sgRNA targeting sequence: Mvk: CACCGCAAGGTCCCGCGGAGTACCA	This paper	N/A
sgRNA targeting sequence: Pmvk: CACCGCTCTCTGGTCCACTCAAGG	This paper	N/A
Inducible shRNA targeting sequence: BAP1: GAGUUCAUCUGCACCUUUA	This paper	N/A
(ChIP-)qPCR primers see Table S1	This paper	N/A

Recombinant DNA

Software and algorithms

GraphPad Prism v.9	GraphpadSoftware	https://www.graphpad.com:443/
FlowJo v.10.6.0	FlowJo, LLC	https://www.flowjo.com/
R (v4.1.1)	R	https://cran.r-project.org/
RStudio (v1.4.1106)	RStudio, PBC	https://www.rstudio.com/
DESeq2 (version1.30.1)	Love et al.⁵⁰	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
MAGeCK algorithm (v0.5.9.4)	Li et al.⁵¹	https://sourceforge.net/p/mageck/wiki/
GSEA (v4.1.0)	UC San Diego	https://www.gsea-msigdb.org/gsea/index.jsp