Figure 1.

Dose–response inhibition of telomerase by phosphoramidate oligonucleotides directed against a non-template region of hTR. Phosphoramidate oligonucleotides were pre-incubated with purified telomerase extract at concentrations ranging from 0.2–125 nM. Primer [100 nM d(TTAGGG)₃] and nucleotides [10 µM dATP (50 c.p.m./fmol [α-³³P]dATP), 50 µM dGTP, 200 µM dTTP] were added and the reactions were incubated for 90 min at 37°C. Enzymatic activity was measured by determining the rate of nucleotide addition to primer as assessed by the incorporation of [α-³³P]dATP into acid insoluble counts (described in Materials and Methods). Activity was plotted as a function of the log of the oligonucleotide concentration. These curves were used to derive the IC₅₀ values shown in Table 1 (Materials and Methods). (A) GRN137155 (ACATTTTTTGTTTGCTCTAG); (B) GRN137159 (GTGGAAGGCGGCAGG).