Skip to main content
. 2023 Mar 3;12:e80040. doi: 10.7554/eLife.80040

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Homo sapiens) P65 hg38 ENSG00000173039
Gene (Homo sapiens) PODXL hg38 ENSG00000128567
Gene (Homo sapiens) ATP1A1 hg38 ENSG00000163399
Gene (Homo sapiens, Mus musculus) RPL7 hg38, mm10 ENSG00000147604, ENSMUSG00000043716
Gene (Homo sapiens, Mus musculus) RPS28 hg38, mm10 ENSG00000233927, ENSMUSG00000067288
Gene (Homo sapiens, Mus musculus) LARP1 hg38, mm10 ENSG00000155506, ENSMUSG00000037331
Gene (Homo sapiens, Mus musculus) NET1 hg38, mm10 ENSG00000173848, ENSMUSG00000021215
Sequence-based reagent LARP1 guide RNA exon2 Synthego GCUGUUCCUAAACAGCGCAA Used to create human LARP1-null cells
Sequence-based reagent LARP1 guide RNA exon19 Synthego CAACCCCCUACACCACCCAC Used to create human LARP1-null cells
Sequence-based reagent AAVS1 guide RNA Synthego UAGUGGCCCCACUGUGGGGU Used to create human loxP cells
Sequence-based reagent Larp1 siRNA IDT mm.RI.Larp1.13.2 Used as equimolar mix
Sequence-based reagent Larp1 siRNA IDT mm.RI.Larp1.13.3 Used as equimolar mix
Sequence-based reagent SSB siRNA IDT mm.RI.Larp1.13.1 Used alone
Sequence-based reagent Larp4 siRNA IDT mm.RI.Larp1.13.1 Used alone
Sequence-based reagent LARP7 siRNA IDT mm.RI.Larp1.13.1 Used alone
Sequence-based reagent FLAP_Y IDT /5Cy3/AA TGC ATG TCG ACG AGG TCC GAG TGT AA/3Cy3Sp/ hybridized to smiFISH probes
Sequence-based reagent RPL7 5'TOP IDT CCTCTTTTTCCGGCTGGAACC used for cloning into reporter constructs
Sequence-based reagent RPL7 mutant 5'TOP IDT AAGAGGGGGAAGGAGGGAAAA used for cloning into reporter constructs
Sequence-based reagent RPS28 5'TOP IDT ACTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATC used for cloning into reporter constructs
Sequence-based reagent RPS28 mutant 5'TOP IDT AAGAAGAGAAGAAAGAAAGAAGAAGAGAAGAAAGA used for cloning into reporter constructs
Cell line (Mus musculus) CAD Sigma 08100805-1VL, RRID: CVCL_0199
Cell line (Mus musculus) CAD/loxP Khandelia et al., 2011 Contains single integration of loxP cassette
Cell line (Homo sapiens) C2bbe1 ATCC CRL-2102
Cell line (Homo sapiens) C2bbe1/loxP Khandelia et al., 2011 Contains single integration of loxP cassette
Cell line (Homo sapiens) HCA-7 ECACC 6061902
Cell line (Homo sapiens) HCA-7/loxP Khandelia et al., 2011 Contains single integration of loxP cassette
Cell line (Canis lupus) MDCK ATCC CRL-2935
Cell line (Canis lupus) MDCK/loxP Khandelia et al., 2011 Contains random integration of loxP cassette
Transfected construct (Homo sapiens) PODXL cDNA Horizon MHS6278-202858197 used for cloning into Halo plasmids
Transfected construct (Homo sapiens) ATP1A1 cDNA Horizon MHS6278-202759485 used for cloning into Halo plasmids
Transfected construct (Homo sapiens) P65 cDNA R.Spitale, UC Irvine used for cloning into Halo plasmids
Transfected construct (Homo sapiens) LARP1 cDNA Horizon MHS6278-202827213 used for cloning into Halo plasmids
Antibody mouse monoclonal anti LARP1 Santa Cruz sc-515873 1:100 dilution for immunoblotting
Antibody mouse monoclonal anti ACTB Sigma A5441 1:5000 for immunoblotting
Antibody mouse monoclonal anti H3 Abcam 10799 1:10000 for immunoblotting
Antibody rabbit polyclonal anti TOM20 ProteinTech 11802–1-AP 1:250 for immunofluorescence
Antibody rabbit polyclonal anti EZRIN Cell Signaling Technology 3145 S 1:250 for immunofluorescence
Antibody mouse monoclonal anti NaKATPase DSHB A5-s 1:50 for immunofluorescence
Sequence-based reagent smFISH probes against Firefly luciferase BioSearch VSMF-1006–5
Commercial assay or kit Zymo Quick-RNA Microprep kit Zymo Research R1050
Commercial assay or kit Zymo Quick-RNA Miniprep kit Zymo Research R1055
Commercial assay or kit Roche RNA HyperPrep Kit with HMR depletion Roche
Other Cell culture inserts for differentiation Corning 353090 C2bbe1 are differentiation on 0.4 uM transwell inserts
Other Kinesore Sigma-Aldrich SML2361 Kinesin-1 Inhibitor
Other Ciliobrevin-A Selleckchem 302803-72-1 Dynein Inhibitor
Other MitoView Green Biotium 70,054 T 100 ng/mL for immunofluorescence imaging of mitochondria
Other Halo-Dibromofluoroscein R.Spitale, UC Irvine ROS producing small molecule for Halo-seq labeling