REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
CD63 antibody [MEM-259]	abcam	Abcam Cat# ab8219, RRID:AB_306364
VPS35 antibody	abcam	Abcam Cat# ab10099, RRID:AB_296841
Glucose Transporter GLUT1 antibody [EPR3915]	abcam	Abcam Cat# ab115730, RRID:AB_10903230
Rabbit Anti-Sodium Potassium ATPase Monoclonal Antibody, Unconjugated, Clone EP1845Y	abcam	Abcam Cat# ab76020, RRID:AB_1310695
EEA1	BD Biosciences	BD Biosciences Cat# 610457, RRID:AB_397830
VPS4A Antibody (A-11)	Santa Cruz Biotechnology	Santa Cruz Biotechnology Cat# sc-393428, RRID:AB_2773025
WWP1 monoclonal antibody (M01A), clone 1A7	Abnova	Abnova Cat# H00011059-M01A, RRID:AB_1717151
GLUT1 antibody	Proteintech	Proteintech Cat# 21829-1-AP, RRID:AB_10837075
Rabbit Anti-NEDD4L Polyclonal Antibody, Unconjugated	Cell Signaling Technology	Cell Signaling Technology Cat# 4013, RRID:AB_1904063
EEA1 (C45B10) Rabbit mAb	Cell Signaling Technology	Cell Signaling Technology Cat# 3288, RRID:AB_2096811
Purified Mouse Anti-LBPA (BMP)	Echelon Biosciences	Echelon Biosciences Cat# Z-PLBPA, RRID:AB_11129226
Rabbit Anti-GAPDH Monoclonal Antibody, Unconjugated, Clone 14C10	Cell Signaling Technology	Cell Signaling Technology Cat# 2118, RRID:AB_561053
Monoclonal ANTI-FLAG® M2 antibody produced in mouse	Millipore	Cat #: F1804; RRID:AB_262044
Mouse anti-Tubulin	Vanderbilt Antibody and Protein Resource Core	N/A
Mouse anti-HA	Vanderbilt Antibody and Protein Resource Core	N/A
DYKDDDDK Tag Polyclonal Antibody	ThermoScientific	Cat #: PA1-984B RRID: AB_347227
Chemicals, peptides, and recombinant proteins
MG-132	APExBIO	Cat# A2585
3-O-methyl-d-glucopyranose	Millipore Sigma	Cat# M4879
EZ-Link NHS-SS-Biotin	Thermo Fisher	Cat# 21331
Phenanthroline	Sigma-Aldrich	Cat# P9375
Iodoacetamide	Sigma-Aldrich	I1149
WWP1 Active human recombinant, expressed in baculovirus infected insect cells	Sigma-Aldrich	Cat# SRP0229
Recombinant Human Usp2 Catalytic Domain	Boston Biochem	Cat# E-504
PNGase F	Promega	V483A
recombinant Shrimp Alkaline Phosphatase	New England BioLabs	Cat# M0371S
Experimental models: Cell lines
Human cells: MDA-MB-231 cells	ATCC	Cat #: MDA-MB-231 (ATCC® HTB-26); RRID:CVCL_0062
Human cells: HEK293T cells	ATCC	Cat# CRL-3216 RRID: CVCL_0063
Human cells: HeLa cells	ATCC	Cat# CCL-2 RRID: CVCL_0030
Human cells: MDA-MB-231 cells stably expressing GLUT1-GFP	This study	N/A
Human cells: HEK293T cells stably expressing FLAG-Ub	This study	N/A
Human cells: HeLa cells stably expressing GLUT1-GFP (WT, 1K245-- > R,11Kcyto-- > R, 6Kloop-- > R, 5Ktails-- > R, 1K245)	This study	N/A
Human cells: HeLa cells stably expressing GLUT1-FLAG	This study	N/A
Human cells: HeLa cells stably expressing FLAGexofacial-GLUT1	This study	N/A
Human cells: HeLa cells stably expressing GFP-GLUT1	This study	N/A
Human cells: HeLa cells stably expressing GLUT1-GFP + TXNIP (WT, cb, py)	This study	N/A
Human cells: HeLa cells stably expressing GLUT1-FLAG + TXNIP (WT, cb, py)	This study	N/A
Oligonucleotides
ojam5373- txnip KO diagnostic primer (F), GGAGGGTGAAAGCTGATTAG	This study	N/A
ojam5374- txnip KO diagnostic primer (R), CACATGCTCACTGCACATTG	This study	N/A
Recombinant DNA
pQCXIN	ClonTech	Cat# 631514
pENTR1A	addgene	Cat# 17398 RRID: Addgene_17398
pInducer20	addgene	Cat# 44012 RRID: Addgene_4401
pRK5-HA-Ubiquitin-WT	addgene	Cat# 17608 RRID: Addgene_17608
WT FLAG-WWP1	Nielsen, C.P. et al.28	N/A
4ww FLAG-WWP1 (W377F, P380A, W409F, P412A, W484F, P487A, F524A, P527A)	Nielsen, C.P. et al.28	N/A
WT WWP1	this study	N/A
WT Nedd4L	this study	N/A
WT TXNIP	this study	N/A
TXNIPcb	this study	N/A
TXNIPpy	this study	N/A
WT TXNIP-FLAG	this study	N/A
TXNIPpy-FLAG	this study	N/A
WT GLUT1-GFP	this study	N/A
WT GLUT1-FLAG	this study	N/A
WT FLAGexofacial-GLUT1	this study	N/A
HA-VPS4A-E228Q	this study	N/A
1K245-- > R GLUT1-GFP	this study	N/A
11Kcyto-- > R GLUT1-GFP	this study	N/A
1K245 GLUT1-GFP	this study	N/A
6Kloop-- > R GLUT1-GFP	this study	N/A
5Ktails-- > R GLUT1-GFP	this study	N/A
VDUP1 CRISPR/Cas9 KO plasmid (h)	Santa Cruz Biotechnology	Cat# sc-400664
Software and algorithms
Softworx	GE	RRID:SCR_019157
MaxQuant	Max Planck Institute of Biochemistry	RRID:SCR_014485
FIJI	NIH	RRID:SCR_002285
Image Studio Lite software	LI-COR	RRID:SCR_013715