Abstract
Arthrofibrosis, which is characterized by excessive scar tissue and limited motion, can complicate the daily functioning of patients after total knee arthroplasty (TKA). Molecular hallmarks of arthrofibrosis include pathologic accumulation of myofibroblasts and disproportionate collagen deposition. Epigenetic mechanisms, including post-translation modification of histones, control gene expression and may regulate fibrotic events. This study assessed the role of the bromodomain and extra-terminal (BET) proteins on myofibroblast differentiation. This group of epigenetic regulators recognize acetylated lysines and are targeted by a class of drugs known as BET inhibitors. RNA-Seq analysis revealed robust mRNA expression of three BET members (BRD2, BRD3, and BRD4) while the fourth member (BRDT) is not expressed in primary TKA knee outgrowth fibroblasts. RT-qPCR and western blot analyses revealed that BET inhibition with the small molecule JQ1 impairs TGFβ1-induced expression of ACTA2, a key myofibroblast marker, in primary outgrowth knee fibroblasts. Similarly, JQ1 administration also reduced COL3A1 mRNA levels and collagen deposition as monitored by picrosirius red staining. Interestingly, the inhibitory effects of JQ1 on ACTA2 mRNA and protein expression, as well as COL3A1 expression and collagen deposition, were paralleled by siRNA-mediated depletion of BRD4. Together, these data reveal that BRD4-mediated epigenetic events support TGFβ1-mediated myofibroblast differentiation and collagen deposition as seen in arthrofibrosis. To our knowledge, these are the first studies that assess epigenetic regulators and their down-stream events in the context of arthrofibrosis. Future studies may reveal clinical utility for drugs that target epigenetic pathways, specifically BET proteins, in the prevention and treatment of arthrofibrosis.
Keywords: BRD4, Bromodomain, Epigenetics, Fibroblast, Myofibroblast, Arthrofibrosis, Total Knee Arthroplasty (TKA)
1. INTRODUCTION
Total knee arthroplasty (TKA) is very commonly performed for end-stage degenerative arthritis [Losina et al., 2009]. Unfortunately, approximately 5% of patients undergoing TKA develop arthrofibrosis [Tibbo et al., 2019]. Arthrofibrosis causes over half of all reoperations or other interventions, and accounts for a quarter of 90-day hospital readmissions following TKA [Abdel et al., 2017; Schairer et al., 2014; Schroer et al., 2013]. While the factors that cause arthrofibrosis are multifactorial and idiopathic [Dagneaux et al., 2020], the hallmarks of this musculoskeletal disease include periarticular fibrotic tissue deposition, which restricts knee motion and impedes activities of daily living [Ibrahim et al., 2020; Tibbo et al., 2019]. Current treatment regimens for patients affected by arthrofibrosis include physical therapy (PT), manipulation under anesthesia (MUA), lysis of adhesions (LOA), and complex revision TKAs [Cheuy et al., 2017]. Unfortunately, these interventions may only provide limited improvements in knee function, yet are often associated with considerable morbidity, discomfort, and cost [Bingham et al., 2019].
The cellular and molecular mechanisms leading to the pathogenesis of knee arthrofibrosis remain largely unexplored. It has been postulated that inflammatory processes following TKA trigger the arthrofibrotic cascade leading to a local increase in cell proliferation, myofibroblast differentiation, and aberrant ECM accumulation but the trigger(s) for this derangement remain elusive [Abdel et al., 2012; Bayram et al., 2020a; Freeman et al., 2009; Morrey et al., 2017; Shimada, 1973; Steplewski et al., 2016]. Mechanistically, it is predicted that transforming growth factor β 1 (TGFβ1/TGFB1) triggers differentiation of fibroblasts into myofibroblasts, which are characterized by enhanced α-smooth muscle alpha-actin (ACTA2) levels and actin stress fiber formation as well as elevated collagen expression (e.g., COL1A1 and COL3A1) followed by excessive extracellular matrix (ECM) deposition [Dagneaux et al., 2020; Frangogiannis, 2020].
Gene expression is regulated by epigenetic mechanisms, including DNA methylation, non-coding RNAs, and post-translational histone tail modifications [Allis and Jenuwein, 2016; Gibney and Nolan, 2010; van Wijnen and Westendorf, 2019]. As for the expansive histone tail modifications, numerous epigenetic enzymes that are divided in various classes of proteins add (i.e., writers), recognize (i.e., readers), and remove (i.e., erasers) these epigenetic changes. This complex histone epigenetic landscape has been implicated in several forms of soft-tissue fibrosis (e.g., lung, kidney, skin) [O’Reilly, 2017]. For example, it was recognized over a decade ago that DNA hypermethylation of the RASAL1 gene contributes to phenotypic changes in fibroblasts implicated in kidney fibrosis [Bechtel et al., 2010]. More recently, it was established that epigenetic changes induced by TGFβ1 activates STAT3 signaling to promote fibroblast to myofibroblast activation and dermal fibrosis in vivo [Dees et al., 2020]. Supporting a link between epigenetic regulation and fibrosis are mechanistic findings which show that the pro-fibrotic factor TGFβ1 changes gene expression by increasing chromatin accessibility by altering the epigenetic landscape within gene regulatory regions [Guerrero-Martínez et al., 2020]. Furthermore, epigenetic alterations may act together with mechanical forces to regulate the fibroblast phenotype and fibrosis [Tschumperlin et al., 2018].
The impact of histone acetylation, a key post-translation modification on histone tails, on cellular phenotypes has been studied extensively due to its involvement in euchromatin formation and gene expression activation [Grunstein, 1997; Sabari et al., 2017]. Histone tail acetylation is controlled by the actions of histone acetyl transferases (HATs; writers) that add, and histone deacetylases (HDACs; erasers) that remove these marks. Initial studies assessing the impact of histone acetylation revealed that targeting of HDACs with HDAC inhibitors (HDIs) impairs the fibrotic process in certain soft tissue models [Mannaerts et al., 2010; Ota et al., 2015; Svegliati et al., 2014; Van Beneden et al., 2013; Zhang et al., 2013]. Based on these extensive HDI studies, the activities of the opposing epigenetic enzymes (i.e., HATs) may promote the fibrotic phenotype. Indeed, it has been established recently that TGFβ1-mediated reduction in MYST1, a HAT that acts on histone 4 lysine 16, promotes an autophagy-mediated mechanism to promote the fibrotic cascade [Zehender et al., 2021]
The epigenetic landscape changes in histone acetylation modulated by HATs and HDACs are recognized and interpreted by bromodomain-containing (BRD) proteins that link epigenetic changes with gene expression [Sanchez and Zhou, 2009]. Within this class of roughly forty BRD proteins, a subset of four proteins known as the bromodomain and extraterminal (BET) proteins (i.e., BRD2, BRD3, BRD4, and BRDT) bind acetylated lysines, interact with the transcriptional machine, and are readily targeted by small compounds knows as BET inhibitors [Dawson et al., 2012; Stathis and Bertoni, 2018; Taniguchi, 2016]. We previously showed that BRD4 supports chondrocyte and osteoblast differentiation, and its activity is required for proper skeletal formation [Paradise et al., 2021; Paradise et al., 2020; Paradise et al., 2022]. These findings provided the opportunity to examine whether BRD4 activity is required for the myofibroblastic differentiation of knee fibroblasts, which similar to osteoblasts and chondrocytes are of mesenchymal origin, and support formation of the collagen-rich tissue that is observed in the knees of patients affected by arthrofibrosis.
Our present studies aim to assess the role of BET protein activity, specifically BRD4, on knee fibroblasts undergoing TGFβ1-induced myofibroblast differentiation. These studies utilize primary knee outgrowth fibroblasts derived from three patients undergoing TKA for osteoarthritis [Bayram et al., 2022], which when under the influence of TGFβ1, represent a unique in vitro cell culture model of arthrofibrosis. Our data reveal robust mRNA expression of BRD4 and other BET proteins in knee fibroblasts. Importantly, inhibition of BET proteins by the small molecule JQ1 and siRNA-mediated BRD4 protein depletion suppresses TGFβ1-mediated myofibroblast differentiation of primary knee fibroblasts. To our knowledge, these are the first studies that assess the contribution of epigenetic events on myofibroblast differentiation of primary knee fibroblasts as an in vitro model of arthrofibrosis, while identifying BET proteins that recognize acetylated histones as specific druggable targets.
2. METHODS
2.1. RNA-Seq analysis
RNA-Seq analysis of primary knee outgrowth fibroblasts derived from patients undergoing primary TKA has been recently performed and described in great detail elsewhere [Bayram et al., 2022]. These data have been deposited in the Gene Expression Omnibus of the National Institute for Biotechnology Information (GSE185333). To examine BET gene expression in knee outgrowth fibroblasts, normalized gene counts were obtained where expression values for each gene were normalized to 1 million reads and corrected for gene length (Fragments Per Kilobase of transcript per Million mapped reads, FPKM).
2.2. Culturing of primary knee outgrowth fibroblasts
Detailed descriptions of specimen collection, processing, and acquisition of primary knee outgrowth fibroblasts from the posterior capsule (PC) of three patients (i.e., 030, 256, and 565) undergoing primary TKA has been previously provided [Bayram et al., 2022]. Cells were grown in advanced minimum essential medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (R&D Systems, Minneapolis, MN), 1% Penicillin/Streptomycin (Thermo Fisher Scientific) and 1% Glutamax (Thermo Fisher Scientific) in cell culture incubators at 37°C, 95% humidity, 21% O2, and 5% CO2 conditions to establish outgrowth cell cultures. All experiments were performed using plastic tissue culture flasks and plates. Passage four and five knee outgrowth fibroblasts were used for all experiments, as was done in our recent study that defines the transcriptional profile and myofibroblast differentiation potential of these cells [Bayram et al., 2022].
2.3. Treatment of cells with JQ1
Cells were plated at a density of 10,000 cells/cm2. At ~80% confluence (Day 0), cells were treated with 100 nM +JQ1 (Cayman Chemicals, Ann Arbor, MI, USA) or its vehicle (DMSO) in the presence of 10 ng/ml TGFβ1 (R&D Systems) or its vehicle (4 mM HCl) in growth medium. We used +JQ1 because it is the biologically relevant active stereoisomer of JQ1 (+JQ1 is referred to as JQ1 herein). Three days later (Day 3), cells were processed and assessed for DNA content by Hoechst staining, RNA expression by RT-qPCR analysis, and protein levels by western blotting. In a second experimental batch, cells were treated for a second time with JQ1, TGFβ1, and the corresponding vehicles. Three days later (Day 6), these cells were processed and examined for DNA content by Hoechst staining, metabolic activity by MTS assay, RNA expression by RT-qPCR analysis, protein levels by western blotting, and collagen deposition by picrosirius red staining.
2.4. siRNA-mediated BRD4 knockdown
Cells were plated at a density of 10,000 cells/cm2. At ~70% confluence (Day 0), cells were transfected with either non-targeting control (Thermo Fisher Scientific) or BRD4-targeting siRNAs (Thermo Fisher Scientific) using Lipofectamine RNAiMAX (Thermo Fisher Scientific) at a final concentration of 20 nM. The next day (Day 1), growth medium supplemented with 10 ng/ml TGFβ1 or its vehicle was added to the cells. Three days later (Day 4), cells were processed and assessed for RNA expression by RT-qPCR analysis and protein levels by western blotting. In a second batch of plates, cells were treated for a second time with TGFβ1 or its vehicle. Three days later (Day 7), cells were analyzed for DNA content by Hoechst staining, metabolic activity by MTS assay, and collagen deposition by picrosirius red staining.
2.5. Hoechst Staining
Hoechst staining was performed to determine DNA content as a surrogate for cell number to account for potential cytotoxic effects resulting from JQ1 treatment and BRD4 knock-down. For this purpose, medium was aspirated, cultures washed in phosphate buffered saline (PBS; Thermo Fisher Scientific), and cell cultures were then fixed in 10% neutral buffered formalin (NBF; Thermo Fisher Scientific) at 4°C. After aspiration of NBF and two washes with PBS, the DNA was stained with Hoechst (Sigma-Aldrich, St. Louis, MO) for 15 minutes in the dark at room temperature. The Hoechst staining solution was carefully aspirated, cells washed two times with PBS, and fluorescence intensity for DNA content was measured using a F200 Infinite Pro (Tecan, Mannedorf, Switzerland) plate reader at 340 nm excitation wavelength and 485 nm emission wavelength in water. Background intensity was subtracted from all readings and DNA content normalized relative to the control samples (cells that have been treated with vehicle solutions for TGFβ1 and JQ1 or vehicle solutions for TGFβ1 and transfected with non-targeting siRNA).
2.6. MTS Activity Assay
As with Hoechst staining, [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) activity assay (Promega, Madison, WI, USA) was performed at indicated time points according to the manufacturer’s protocol to assess for cytotoxic effects following JQ1 treatment and BRD4 knock-down. MTS activity was collected at 490 nm using a SpectraMAX Plus spectrophotometer (Molecular Devices, San Jose, CA), background intensity subtracted from each value, and MTS activity was normalized relative to the control samples as defined above.
2.7. Picrosirius Red Staining
After Hoechst staining (same tissue culture plates), cells were analyzed with picrosirius red staining kit (Polysciences Inc., Warrington, PA, USA) to detect the amount of collagen deposition according to the manufacturer’s protocol. After drying the plates, representative images were taken using a SteREO Discovery V8 (Zeiss, Jena, Germany) and staining was quantified using ImageJ software. Picrosirius staining intensity was normalized relative to the control samples as defined above.
2.8. Gene Expression Analysis
Cells were lysed using TRI-Reagent (Zymo Research, Irvine, CA, USA) and RNA was isolated using the Direct-zol RNA isolation kit (Zymo Research) following the manufacturers protocol. The resulting RNA was quantified and quality tested using a NanoDrop 2000 spectrophotometer (Thermo Fischer Scientific). RNA was reverse transcribed into cDNA using the Promega Reverse Transcription kit and protocol (Promega). Gene expression was then analyzed by real-time quantitative PCR with QuantiTect SYBR Green PCR Kit (Qiagen, Hilden, Germany) and the CFX384 Real-Time System (BioRad, Hercules, CA, USA). Transcript levels were quantified using the 2ΔΔCt method and normalized to the housekeeping gene GAPDH. The following primer pairs were used: GAPDH forward - ATGTTCGTCATGGGTGTGAA, GAPDH reverse - TGTGGTCATGAGTCCTTCCA, BRD4 forward - GAAACAGGAGCCGAAGACTC, BRD4 reverse - GGAGCCCATGTTCTTGATTT, ACTA2 forward - AAAAGACAGCTACGTGGGTGA, ACTA2 reverse - GCCATGTTCTATCGGGTACTTC, COL3A1 forward - TTGAAGGAGGATGTTCCCATCT, COL3A1 reverse - ACAGACACATATTTGGCATGGTT. After GAPDH normalization for each sample, gene expression was then normalized to the control samples as defined above.
2.9. Western Blotting Analysis
Western blotting was performed as previously described [Bayram et al., 2020b; Bayram et al., 2022; Dudakovic et al., 2015]. Briefly, cells were lysed with radio-immunoprecipitation (Thermo Fischer Scientific) supplemented with protease and phosphatase inhibitor cocktail (Thermo Fischer Scientific) and proteins quantified via the DC Protein Assay Kit II (Bio-Rad, Hercules, CA, USA). Proteins were resolved in SDS-PAGE gels and transferred to a nitrocellulose membrane. Following primary and secondary antibody incubations, protein bands were visualized with the SuperSignal™ West Pico PLUS Chemiluminescent Substrate kit (Thermo Fisher Scientific) and the ChemiDocTM Touch Imaging System (BioRad). Primary antibodies and concentrations used for western blotting were as follows: GAPDH (1:30,000; ab181602; Abcam, Cambridge, United Kingdom), BRD4 (1:2,000; A301–985A, Bethyl Labs, Montgomery, TX, USA), and ACTA2 (1:1000; ab21027; Abcam).
2.10. Statistical Analysis
All graphing and statistical analyses were performed using GraphPad Prism version 9.3.1 (GraphPad Software, San Diego, CA, USA). For statistical analysis, relevant groups were compared using one-way ANOVA. When applicable, significance is noted in the figures with a standard asterisk convention (* = p ≤ 0.05, ** = p ≤ 0.01, *** = p ≤ 0.001, **** = p ≤ 0.0001).
3. RESULTS
3.1. BET protein expression in primary knee outgrowth fibroblasts
We recently established that primary knee outgrowth fibroblasts derived from three anatomical regions (posterior capsule - PC, quadriceps tendon - QT, and suprapatellar pouch - SP) of patients undergoing primary TKA (pTKA) exhibit a similar, but unique gene expression profile within the fibroblastic niche, and readily undergo myofibroblast differentiation in the presence of TGFβ1 [Bayram et al., 2022]. To define mRNA expression patterns of BET proteins in these knee outgrowth fibroblasts, we analyzed available RNA-Seq data [Bayram et al., 2022] (Figure 1). BET proteins exhibit similar expression profiles across knee outgrowth fibroblasts derived from three anatomical regions (i.e., PC, QT, SP). BRD2 is the most abundantly expressed (~30 FPKM) BET family member, while BRDT is not detected by RNA-Seq assessment. Of note, similar expression patterns are observed between BRD3 and BRD4 (~5 FPKM). For comparison, all three joint cell types express robust levels of the fibroblast related transcription factors TWIST1, PRRX1 and SOX4, but not the tenocyte marker SCX (SCXA and SCXB), reflecting the fibroblastic nature of cells isolated from connective tissues around the joint. Together, these data establish that BET proteins BRD2, BRD3 and BRD4 are transcribed in primary knee outgrowth fibroblasts.
Figure 1. Expression of BET family members in primary knee fibroblasts.
mRNA expression levels (FPKM) for BET family members (BRD2, BRD3, BRD4, and BRDT) (A) and relevant transcription factors (B) by RNA-sequencing in primary outgrowth fibroblasts derived from three anatomical regions from knees of patients undergoing PTKA (n = 4 for each anatomical region; PC = posterior capsule, QT = quadriceps tendon, and SP = suprapatellar pouch). All error bars represent ± STD of four biological replicates.
3.2. Toxicity profile of JQ1 in primary knee outgrowth fibroblasts
JQ1 is a small molecule inhibitor that binds to bromodomains of BET proteins and interferes with the recognition and binding to acetylated targets [Filippakopoulos et al., 2010]. To monitor toxicity and myofibroblast differentiation, PC-derived primary knee outgrowth fibroblasts (n = 3 patients, i.e., 030, 256, and 565) were treated with established concentration of JQ1 (100 nM) [Paradise et al., 2020; Paradise et al., 2022] in the presence or absence of TGFβ1 (10 ng/ml) [Bayram et al., 2022] (Figure 2A). Hoechst staining revealed that JQ1 reduces DNA content to some extent in the absence of TGFβ1 (Figure 2B). These trends were observed across all three cells lines, albeit significance was only reached in a subset of comparisons. Interestingly, while TGFβ1 by itself enhanced DNA content on day six in 256 cells only, JQ1 did not reduce DNA content in the presence of TGFβ1. In support of DNA content findings, JQ1 administration did not alter metabolic activity of fibroblast cell cultures as evaluated by MTS activity assay (Suppl. Figure 1A). Taken together, these data reveal that JQ1 does not impact MTS activity and modestly decreases DNA content in the absence of TGFβ1, but these relative minor cytotoxic effects of this epigenetic drug are mitigated in the presence of TGFβ1.
Figure 2. Toxicity profile of JQ1 in primary knee fibroblasts.
(A) Experimental outline describing the culture and treatment of three PC-derived primary knee fibroblasts (i.e., 030, 256, 565) with 100 nM JQ1 and 10 ng/ml TGFβ1. As relevant controls, cells were treated with DMSO (JQ1 vehicle) with 4mM HCl (TGFβ1 vehicle). (B) DNA content by Hoechst staining on days three (top) and six (bottom). All error bars represent ± STD of three experimental replicates. Significance is noted with a standard asterisk convention between relevant groups (ns = not significant, *= p ≤ 0.05, **= p ≤ 0.01, ***= p ≤ 0.001, ****= p ≤ 0.0001).
3.3. BET inhibition reduces TGFβ1-mediated ACTA2 expression
Having established the lack of overt toxicity following JQ1 (100 nM) administration, we next assessed whether BET inhibition can prevent TGFβ1-mediated myofibroblast differentiation. As anticipated, TGFβ1 enhances the expression of the myofibroblast marker ACTA2 at the mRNA (Figure 3A) and protein (Figure 3B, Suppl. Figure 2A) level after three and six days of treatment. Overall, JQ1 reduces ACTA2 mRNA and protein basal levels in the absence of TGFβ1, albeit these trends are subtle and fail to reach statistical significance at the mRNA level. However, JQ1 administration abolishes TGFβ1-mediated upregulation of ACTA2 at mRNA and protein levels in all three primary knee outgrowth cell lines on day three and six of myofibroblast differentiation. Thus, our data indicate that BET inhibition suppresses TGFβ1-mediated ACTA2 expression in primary knee fibroblasts.
Figure 3. JQ1 reduces TGFβ1-regulated ACTA2 mRNA and protein levels in primary knee fibroblasts.
Primary knee fibroblasts from three different patients (i.e., 030, 256, and 565) were cultured and treated as described in Figure 2A. (A) RT-qPCR analysis for ACTA2 relative to GAPDH on days three (top) and six (bottom). (B) Western blot analysis for ACTA2 and GAPDH proteins on days three (top) and six (bottom). All error bars represent ± STD of three experimental replicates. Significance is noted with a standard asterisk convention between relevant groups (ns = not significant, *= p ≤ 0.05, **= p ≤ 0.01, ***= p ≤ 0.001, ****= p ≤ 0.0001).
3.4. BET inhibition suppresses collagen expression and deposition
To further investigate the involvement of BET protein on myofibroblast differentiation, we utilized RT-qPCR analysis and picrosirius red staining to monitor COL3A1 expression on day three and collagen deposition on day six, respectively. Similar to ACTA2, COL3A1 gene expression is significantly up-regulated by TGFβ1 in all three primary cells lines at three days after treatment (Figure 4A). While JQ1 does not alter COL3A1 expression in the basal state (i.e., in the absence of TGFβ1), this epigenetic drug significantly suppresses TGFβ1-induced COL3A1 levels in two cell lines. In support of COL3A1 expression, TGFβ1 enhances collagen deposition in all three cell lines (Figure 4B), which is suppressed by the co-administration of JQ1 in two cells lines. As with COL3A1 expression, statistical testing did not reveal a significant reduction in collagen deposition with JQ1 administration in the absence of TGFβ1, but a decrease in collagen levels is observed. In sum, these studies reveal that JQ1 reduces TGFβ1-mediated COL3A1 expression and collagen deposition.
Figure 4. JQ1 suppresses TGFβ1-induced COL3A1 expression and collagen deposition.
Primary knee fibroblasts (i.e., 030, 256, and 565) were cultured and treated as described in Figure 2A. (A) RT-qPCR analysis for COL3A1 relative to GAPDH on day three. (B) Picrosirius red staining and quantification on day six. All error bars represent ± STD of three experimental replicates. Significance is noted with a standard asterisk convention between relevant groups (ns = not significant, *= p ≤ 0.05, **= p ≤ 0.01, ***= p ≤ 0.001, ****= p ≤ 0.0001).
3.5. Robust depletion of BRD4 expression in primary knee outgrowth fibroblasts
Because we previously showed that BRD4 is required for osteogenic and chondrogenic differentiation and skeletal formation [Paradise et al., 2021; Paradise et al., 2020; Paradise et al., 2022], we sought to determine whether the effects of BET inhibition (i.e., JQ1) on myofibroblast differentiation can be mirrored by BRD4 depletion (Figure 5A). Robust siRNA-mediated BRD4 depletion is confirmed by RT-qPCR (Figure 5B) and western blotting (Figure 6, Suppl. Figure 2B) four days after transfection in all three primary cell lines. To assess for changes in DNA content and metabolic activity in the cultures, Hoechst staining and MTS activity assay were performed seven days after administration of control and BRD4 siRNAs (Figure 5D). In the present cultures, TGFβ1 significantly enhances the DNA content in all three cell lines. While BRD4 depletion did not impact DNA content in basal condition, the TGFβ1-enhanced DNA content is blunted upon BRD4 depletion. MTS activity did not change upon TGFβ1 and BRD4 siRNA treatment (Suppl. Figure 1B). Together, these data establish that siRNA-mediated BRD4 depletion is effective and accompanied by a reduction in total DNA content without noticeable alterations in MTS activity in TGFβ1-treated cell cultures.
Figure 5. Robust siRNA-mediated BRD4 depletion in primary knee outgrowth fibroblasts.
(A) Experimental outline describing the culture and treatment of three PC-derived primary knee fibroblasts (i.e., 030, 256, 565) with BRD4 siRNA and 10 ng/ml TGFβ1. As relevant controls, cells were transfected with control siRNA and/or treated with 4mM HCl (TGFβ1 vehicle). (B) RT-qPCR analysis for BRD4 relative to GAPDH on day four. (C) DNA content by Hoechst staining on day seven. All error bars represent ± STD of three experimental replicates. Significance is noted with a standard asterisk convention between relevant groups (ns = not significant, *= p ≤ 0.05, **= p ≤ 0.01, ***= p ≤ 0.001, ****= p ≤ 0.0001).
Figure 6. Depletion of BRD4 reduces ACTA2 protein levels in primary knee fibroblasts.
Primary knee fibroblasts (i.e., 030, 256, and 565) were cultured and treated as described in Figure 5A. Western blotting analysis for BRD4, ACTA2 and GAPDH proteins on day four.
3.6. BRD4 depletion reduces ACTA2 protein levels
To assess the impact of BRD4 depletion in basal and TGFβ1-stimulated primary knee outgrowth fibroblasts on the myofibroblast marker ACTA2, western blotting analysis was performed. While ACTA2 protein levels are enhanced by TGFβ1 (robust change in two cell lines), the depletion of BRD4 reduces basal and TGFβ1-enhanced ACTA2 protein levels (Figure 6, Suppl. Figure 2B). These studies establish that BRD4 function supports basal and TGFβ1-induced ACTA2 expression in primary knee outgrowth fibroblasts. Furthermore, the results with BRD4 depletion parallel results obtained for JQ1, suggesting that BRD4 is the primary BET protein targeted by JQ1 in fibroblasts.
3.7. BRD4 knock-down suppresses collagen expression and deposition
In addition to ACTA2 expression, the contribution of BRD4 on myofibroblast differentiation of primary outgrowth knee fibroblasts was also assessed by RT-qPCR analysis for COL3A1 and picrosirius red staining for collagen deposition. Four days after transfection, robust increase in COL3A1 expression is observed with the administration of TGFβ1 in all three cell lines transfected with control siRNA (Figure 7A). In general, BRD4 depletion reduces COL3A1 gene expression in basal conditions, but significance is only reached in two of the three cell lines. Importantly, BRD4 depletion completely inhibits TGFβ1-mediated COL3A1 up-regulation in all three cell lines. Of interest, COL3A1 gene expression is mirrored by collagen deposition on day seven (Figure 7B). While TGFβ1 administration significantly enhances collagen deposition, concurrent depletion of BRD4 significantly blunts these increases in collagen content. No significant changes are observed between control and BRD4 siRNA in the absence of exogenous TGFβ1 supplementation. In sum, these studies demonstrate that BRD4 is required for COL3A1 expression and collagen deposition during TGFβ1-mediated myofibroblast differentiation of primary knee outgrowth cells.
Figure 7. BRD4 depletion reduces COL3A1 expression and collagen deposition.
Primary knee fibroblasts (i.e., 030, 256, and 565) were cultured and treated as described in Figure 5A. (A) RT-qPCR analysis for COL3A1 relative to GAPDH on day four. (B) Picrosirius red staining and quantification on day seven. All error bars represent ± STD of three experimental replicates. Significance is noted with a standard asterisk convention between relevant groups (ns = not significant, *= p ≤ 0.05, **= p ≤ 0.01, ***= p ≤ 0.001, ****= p ≤ 0.0001).
4. DISCUSSION
Our present study reveals that BRD2, BRD3, and BRD4, which are three out of the four genes that encode BET proteins, are expressed at the mRNA level in primary knee outgrowth fibroblasts as assessed by RNA-Seq analysis. On the other hand, the fourth family member, BRDT is not expressed in this cell model. Our previous gene expression assessment by RNA-Seq of other mesenchymally-derived cells, which includes human adipose-derived mesenchymal stem cells and mouse calvarial pre-osteoblasts, revealed similar BET gene expression patterns [Dudakovic et al., 2017; Paradise et al., 2020]. In all these models, BRD2 was the most abundantly expressed member while no appreciable detection was noted for BRDT, which is the testis-specific member of this family [Dawson et al., 2012; Stathis and Bertoni, 2018]. This ubiquitous expression pattern of BRD2, BRD3, and BRD4 in mesenchymal cells and other cellular systems [Dawson et al., 2012; Stathis and Bertoni, 2018] suggests that these epigenetic regulators are required for key cellular processes. For example, and in support of the ubiquitous roles of BET members, germline deletion of Brd4 in mice is embryonically lethal, while heterozygous animals are viable but exhibit skeletal-related abnormalities [Houzelstein et al., 2002]. The contribution of Brd4 to skeletal formation is further supported by our recent studies showing that conditional depletion of Brd4 in the mesenchyme compromises skeletal formation [Paradise et al., 2022]. The important role of BRD4 on skeletal development is further supported by missense mutations in human BRD4, which are linked to skeletal abnormalities, and copy number variations in BRD4, which are linked with craniofacial irregularities [Cao et al., 2016; Jin et al., 2017].
The BET class of BRD proteins is targeted by BET inhibitors such as JQ1 [Dawson et al., 2012; Stathis and Bertoni, 2018; Taniguchi, 2016]. Our present studies establish that a non-toxic concentration of JQ1 (100 nM) suppresses myofibroblast differentiation of primary outgrowth knee fibroblasts. To our knowledge, this is the first study that assesses the contribution of BET proteins and any other epigenetic events on myofibroblast differentiation in an arthrofibrosis-related model. However, other studies have demonstrated that targeting of BET proteins is anti-fibrotic in several models of soft tissue fibrosis, including kidney [Xiong et al., 2016; Zhou et al., 2017], liver [Ding et al., 2021; Middleton et al., 2018], skin [Vichaikul et al., 2022], and lung [Kaneshita et al., 2021; Tang et al., 2013a; Wang et al., 2018]. The role of epigenetics, including BET proteins, in soft tissue fibrosis has also been extensively summarized in review articles [O’Reilly, 2017; Rani et al., 2021]. Recent studies using foreskin and dermal fibroblasts also demonstrate that targeting of BET protein suppresses radiotherapy-induced fibrosis [Liu et al., 2022], suggesting that JQ1 and similar molecules can alleviate the pro-fibrotic events induced by external insults. This is relevant to arthrofibrosis as this skeletal disease typically manifests following TKA [Tibbo et al., 2019], a surgical insult to the knee tissue that, similar to radiation, may be a factor that triggers the arthrofibrotic cascade for some patients.
A recent study by Williams and colleagues demonstrated that the acetyltransferase CREBBP/EP30 controls pro-fibrotic processes in cells derived from Dupuytren’s disease, a fibrotic disease involving the palma fascia [Williams et al., 2020]. Of note, their genomic approaches revealed that EP300 is enriched at enhancers linked to fibrotic genes and that the targeting of EP300 (SGC-CBP30) and BET proteins (JQ1) interfered with the fibrotic process in fibroblasts from Dupuytren’s disease. Thus, these recent studies suggest that deposition of acetylated lysines by HATs or the potential recognition of acetylated lysines by BET proteins can suppress fibrotic processes in musculoskeletal related diseases, which is supported by our present studies revealing the BET inhibition suppresses myofibroblast differentiation in a primary cell model of arthrofibrosis.
While BET-targeting agents such as JQ1 alter activities of several BET proteins, our present target validation focused on BRD4 as our recent studies revealed a unique role for this protein in mesenchymal lineage differentiation and skeletal formation [Paradise et al., 2021; Paradise et al., 2020; Paradise et al., 2022]. Although BRD2 mRNA levels are higher in pre-osteoblasts, BRD4 depletion was more robust at inhibiting osteogenic commitment when compared to BRD2 depletion [Paradise et al., 2020], suggesting that BRD4 is a critical epigenetic regulator of lineage allocation of mesenchymal progenitors. The contribution of BRD4 on the differentiation of mesenchymal progenitors is further supporter by studies showing the allocation of BRD4 to lineage-specific genes after the administration of differentiation stimuli [Najafova et al., 2017; Paradise et al., 2020]. Indeed, siRNA-mediated depletion of BRD4 paralleled the phenotypic changes that are associated with BET inhibition via JQ1 in primary knee fibroblasts undergoing TGFβ1-mediated myofibroblast differentiation. In support, one of the earlier studies assessing the role of BET protein on fibrosis revealed that BRD4 and BRD2 depletion interfered with myofibroblast differentiation of human lung fibroblasts [Tang et al., 2013b]. While the majority of studies have been focused on assessing the utility of BET inhibitors on fibrotic processes [Ding et al., 2015; Stratton et al., 2019; Zhu et al., 2020], several studies have shown a direct link between BRD4 and fibrosis, supporting our present contribution of BRD4 on myofibroblast differentiation of knee fibroblasts. Mechanistically, following an exposure to a fibrotic stimulus, BRD4 may selectively bind to gene regulatory regions, including enhancers and super-enhancers, to support pro-fibrotic gene expression [Alexanian et al., 2021; Stratton et al., 2019; Wilflingseder et al., 2020], similar to what is observed during normal lineage allocation of progenitor cells [Lee et al., 2017; Najafova et al., 2017]. Alternatively, TGFβ1 and downstream fibrotic cues may alter post-translational modification of histones [Kato et al., 2013; Smith et al., 2019; Sun et al., 2010; Yuan et al., 2013] to recruit BRD4 and the transcriptional machinery to fibrotic genes. Additional studies in knee fibroblasts are warranted to tease out mechanistic details that implicate BRD4 and TGFβ1-mediated myofibroblast differentiation.
Interestingly, it has been shown that targeting of BET proteins may also exert anti-fibrotic activities by reducing the activation of the inflammatory cascade [Duan et al., 2017; Fu et al., 2022]. The connection between inflammation, fibrosis, and BET proteins is especially of interest to our group as our studies have previously shown that targeting the inflammatory cascade alleviates contracture formation in a rabbit model of arthrofibrosis [Limberg et al., 2020; Salib et al., 2019; Trousdale et al., 2022]. The connection between inflammation and local BET protein inhibition is also supported by a study which showed that delivery of JQ1 into the knee alleviates osteoarthritis in mice [Jiang et al., 2017]. Collectively, these observations suggest that targeting BET proteins alone or in combination with anti-inflammatory agents within the local knee environment in established rat [Owen et al., 2022] and rabbit models [Nesterenko et al., 2009] of arthrofibrosis could be explored in the future. Local delivery of JQ1 or other BET inhibitors would mainly target cells that support the knee arthrofibrotic process with limited effects on other cells and organ systems.
Our study is not without limitations and warrants future studies focused on the role of BET proteins and arthrofibrosis. While our studies reveal mRNA expression profiles of BET members, additional assay could be considered in the future to evaluate protein levels of BET members in our cell cultures as translational and post-translational mechanisms may affect protein levels. However, our studies reveal that BRD4 is indeed expressed at the protein level in our knee fibroblasts and its depletion interferes with myofibroblast differentiation. While our studies utilize a previously established cell culture model employing primary knee outgrowth fibroblasts from the knee [Bayram et al., 2022], additional studies using BET inhibitors and siRNA-mediated BRD4 knock-down could be performed in primary cells derived from patients affected by arthrofibrosis. However, because the majority of TKAs are performed for osteoarthritis and arthrofibrosis typically manifests itself following TKA [Tibbo et al., 2019], the use of the present cell model collected at time of TKA is of great relevance to arthrofibrosis. Additional limitations include the use of primary outgrowth because cells isolated by primary digests as described in the Dupuytren’s disease study [Williams et al., 2020] may provide a more disease-relative alternative. Our study cultures cells in fetal bovine serum as the growth stimulus, but synthetic human growth media or human platelet lysate [Crespo-Diaz et al., 2011; Dudakovic et al., 2014] would represent more physiologically compatible alternatives. Our studies could have explored the use of additional BET inhibitors (e.g., IBET-762) and assessed the functional consequences of depleting other BET family members (i.e., BRD2 and BRD3). However, additional drug-based studies could be considered redundant. Also, because BRD4 depletion paralleled the effects of JQ1, we reasoned that the inhibitory effects toward myofibroblast differentiation by JQ1 (and any other BET inhibitor) is a consequence of interfering with the activity of BRD4. Similar trends between JQ1 and BRD4 depletion on lineage differentiation have been previously reported by our group [Paradise et al., 2020]. Another limitation of our study is the absence of assays (i.e., chromatin immunoprecipitation followed by PCR or sequencing) that evaluate BRD4 occupancy at fibrotic genes, including ACTA2, in the presence or absence of TGFβ1. Beyond the robust myofibroblast differentiation effects by TGFβ1, JQ1, and BRD4 depletion, we also acknowledge more settle effect of these agents on the DNA content in the primary knee fibroblast cultures. While TGFβ1 has been documented to regulate cell proliferation [Kim et al., 2018; Meng et al., 2016], which may the mechanisms by which DNA content is increased in our studies by this potent cytokine, it remains to be determined to what extend TGFβ1 regulates proliferation of knee fibroblasts. Similarly, while the effects of BRD4 and BET inhibitors on proliferation are established especially in the context of cancer [Donati et al., 2018; Filippakopoulos et al., 2010], it remains to be seen how alterations in proliferation impact the differentiation potential of knee fibroblasts. Thus, additional studies should be considered that further evaluate the mechanism by which BRD4 regulates TGFβ1-mediated myofibroblast differentiation. Finally, our studies are exclusively in vitro and the inclusion of in vivo studies using relevant animal models, including rats and rabbits [Nesterenko et al., 2009; Owen et al., 2022], would significantly strengthen the potential link between BET proteins and arthrofibrosis.
In summary, our present studies establish that BET inhibition or BRD4 depletion each inhibit TGFβ1-mediated myofibroblast differentiation of primary knee outgrowth fibroblasts. To our knowledge, this is the first study that assesses the impact of epigenetic events using an in vitro model highly relevant to arthrofibrosis. Future studies could focus on defining additional epigenetic mechanisms that contribute to the fibrotic process in knee-derived fibroblasts and the implementation of pioneering in vivo studies could focus on defining the utility of BET inhibitors in the prevention and treatment of arthrofibrosis.
Supplementary Material
ACKNOWLEDGMENTS
This study was pursued with the generous philanthropic support of Anna-Maria and Stephen Kellen Foundation (to MPA). This work was also supported in part by the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institutes of Health (R01 AR072597 to MPA) and a Career Development Award in Orthopedics Research (to AD). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
Institution where reported work was performed:
Mayo Clinic, Rochester, MN, USA
Footnotes
CONFLICTS OF INTEREST
Amel Dudakovic (N), Banu Bayram (Elsevier), Jacob W. Bettencourt (N), Afton K. Limberg (N), M. Lizeth Galvan (N), Margarita E Carrasco (N), Britta Stans (N), Roman Thaler (N), Mark E. Morrey (Elsevier), Joaquin Sanchez-Sotelo (Acumed, American Shoulder and Elbow Surgeons, Elsevier, Exactech, JSES, Oxford University Press, Precision OS, PSI, Stryker), Daniel J. Berry (Bodycad, Current Concepts in Joint Replacement, DePuy, Elsevier, International Hip Society, JBJS, OREF, Wolters Kluwer Health - Lippincott Williams & Wilkins), Andre J. van Wijnen (N), Matthew P. Abdel (Hip Society, ICJR, MAOS, Springer, Stryker).
DATA AVAILABILITY STATEMENT
Datasets utilized in this study are archived in the Gene Expression Omnibus of the National Institute for Biotechnology Information (GSE185333).
REFERENCES
- Abdel MP, Ledford CK, Kobic A, Taunton MJ, Hanssen AD. 2017. Contemporary failure aetiologies of the primary, posterior-stabilised total knee arthroplasty. Bone Joint J 99-b:647–652. [DOI] [PubMed] [Google Scholar]
- Abdel MP, Morrey ME, Barlow JD, Kreofsky CR, An KN, Steinmann SP, Morrey BF, Sanchez-Sotelo J. 2012. Myofibroblast cells are preferentially expressed early in a rabbit model of joint contracture. J Orthop Res 30:713–9. [DOI] [PubMed] [Google Scholar]
- Alexanian M, Przytycki PF, Micheletti R, Padmanabhan A, Ye L, Travers JG, Gonzalez-Teran B, Silva AC, Duan Q, Ranade SS, Felix F, Linares-Saldana R, Li L, Lee CY, Sadagopan N, Pelonero A, Huang Y, Andreoletti G, Jain R, McKinsey TA, Rosenfeld MG, Gifford CA, Pollard KS, Haldar SM, Srivastava D. 2021. A transcriptional switch governs fibroblast activation in heart disease. Nature 595:438–443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Allis CD, Jenuwein T. 2016. The molecular hallmarks of epigenetic control. Nat Rev Genet 17:487–500. [DOI] [PubMed] [Google Scholar]
- Bayram B, Limberg AK, Salib CG, Bettencourt JW, Trousdale WH, Lewallen EA, Reina N, Paradise CR, Thaler R, Morrey ME, Sanchez-Sotelo J, Berry DJ, van Wijnen AJ, Abdel MP. 2020a. Molecular pathology of human knee arthrofibrosis defined by RNA sequencing. Genomics 112:2703–2712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bayram B, Owen AR, Dudakovic A, Dagneaux L, Turner TW, Bettencourt JW, Limberg AK, Tibbo ME, Morrey ME, Sanchez-Sotelo J, Berry DJ, Kocher JA, Wijnen AJV, Abdel MP. 2020b. A Potential Theragnostic Regulatory Axis for Arthrofibrosis Involving Adiponectin (ADIPOQ) Receptor 1 and 2 (ADIPOR1 and ADIPOR2), TGFβ1, and Smooth Muscle α-Actin (ACTA2). J Clin Med 9:3690. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bayram B, Thaler R, Bettencourt JW, Limberg AK, Sheehan KP, Owen AR, Berry DJ, Morrey ME, Sanchez-Sotelo J, van Wijnen AJ, Dudakovic A, Abdel MP. 2022. Human outgrowth knee fibroblasts from patients undergoing total knee arthroplasty exhibit a unique gene expression profile and undergo myofibroblastogenesis upon TGFβ1 stimulation. J Cell Biochem 123:878–892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bechtel W, McGoohan S, Zeisberg EM, Müller GA, Kalbacher H, Salant DJ, Müller CA, Kalluri R, Zeisberg M. 2010. Methylation determines fibroblast activation and fibrogenesis in the kidney. Nat Med 16:544–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bingham JS, Bukowski BR, Wyles CC, Pareek A, Berry DJ, Abdel MP. 2019. Rotating-Hinge Revision Total Knee Arthroplasty for Treatment of Severe Arthrofibrosis. J Arthroplasty 34:S271–s276. [DOI] [PubMed] [Google Scholar]
- Cao Y, Li Z, Rosenfeld JA, Pursley AN, Patel A, Huang J, Wang H, Chen M, Sun X, Leung TY, Cheung SW, Choy KW. 2016. Contribution of genomic copy-number variations in prenatal oral clefts: a multicenter cohort study. Genet Med 18:1052–5. [DOI] [PubMed] [Google Scholar]
- Cheuy VA, Foran JRH, Paxton RJ, Bade MJ, Zeni JA, Stevens-Lapsley JE. 2017. Arthrofibrosis Associated With Total Knee Arthroplasty. J Arthroplasty 32:2604–2611. [DOI] [PubMed] [Google Scholar]
- Crespo-Diaz R, Behfar A, Butler GW, Padley DJ, Sarr MG, Bartunek J, Dietz AB, Terzic A. 2011. Platelet lysate consisting of a natural repair proteome supports human mesenchymal stem cell proliferation and chromosomal stability. Cell Transplant 20:797–811. [DOI] [PubMed] [Google Scholar]
- Dagneaux L, Owen AR, Bettencourt JW, Barlow JD, Amadio PC, Kocher JP, Morrey ME, Sanchez-Sotelo J, Berry DJ, van Wijnen AJ, Abdel MP. 2020. Human Fibrosis: Is There Evidence for a Genetic Predisposition in Musculoskeletal Tissues? J Arthroplasty 35:3343–3352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dawson MA, Kouzarides T, Huntly BJ. 2012. Targeting epigenetic readers in cancer. N Engl J Med 367:647–57. [DOI] [PubMed] [Google Scholar]
- Dees C, Pötter S, Zhang Y, Bergmann C, Zhou X, Luber M, Wohlfahrt T, Karouzakis E, Ramming A, Gelse K, Yoshimura A, Jaenisch R, Distler O, Schett G, Distler JH. 2020. TGF-β-induced epigenetic deregulation of SOCS3 facilitates STAT3 signaling to promote fibrosis. J Clin Invest 130:2347–2363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding H, Yang X, Tian J, Wang X, Ji Y, El-Ashram S, Ren C, Shen J, Liu M. 2021. JQ-1 ameliorates schistosomiasis liver fibrosis by suppressing JAK2 and STAT3 activation. Biomed Pharmacother 144:112281. [DOI] [PubMed] [Google Scholar]
- Ding N, Hah N, Yu RT, Sherman MH, Benner C, Leblanc M, He M, Liddle C, Downes M, Evans RM. 2015. BRD4 is a novel therapeutic target for liver fibrosis. Proc Natl Acad Sci U S A 112:15713–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Donati B, Lorenzini E, Ciarrocchi A. 2018. BRD4 and Cancer: going beyond transcriptional regulation. Mol Cancer 17:164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duan Q, McMahon S, Anand P, Shah H, Thomas S, Salunga HT, Huang Y, Zhang R, Sahadevan A, Lemieux ME, Brown JD, Srivastava D, Bradner JE, McKinsey TA, Haldar SM. 2017. BET bromodomain inhibition suppresses innate inflammatory and profibrotic transcriptional networks in heart failure. Sci Transl Med 9:eaah5084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dudakovic A, Camilleri E, Riester SM, Lewallen EA, Kvasha S, Chen X, Radel DJ, Anderson JM, Nair AA, Evans JM, Krych AJ, Smith J, Deyle DR, Stein JL, Stein GS, Im HJ, Cool SM, Westendorf JJ, Kakar S, Dietz AB, van Wijnen AJ. 2014. High-resolution molecular validation of self-renewal and spontaneous differentiation in clinical-grade adipose-tissue derived human mesenchymal stem cells. J Cell Biochem 115:1816–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dudakovic A, Camilleri ET, Xu F, Riester SM, McGee-Lawrence ME, Bradley EW, Paradise CR, Lewallen EA, Thaler R, Deyle DR, Larson AN, Lewallen DG, Dietz AB, Stein GS, Montecino MA, Westendorf JJ, van Wijnen AJ. 2015. Epigenetic Control of Skeletal Development by the Histone Methyltransferase Ezh2. J Biol Chem 290:27604–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dudakovic A, Gluscevic M, Paradise CR, Dudakovic H, Khani F, Thaler R, Ahmed FS, Li X, Dietz AB, Stein GS, Montecino MA, Deyle DR, Westendorf JJ, van Wijnen AJ. 2017. Profiling of human epigenetic regulators using a semi-automated real-time qPCR platform validated by next generation sequencing. Gene 609:28–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Filippakopoulos P, Qi J, Picaud S, Shen Y, Smith WB, Fedorov O, Morse EM, Keates T, Hickman TT, Felletar I, Philpott M, Munro S, McKeown MR, Wang Y, Christie AL, West N, Cameron MJ, Schwartz B, Heightman TD, La Thangue N, French CA, Wiest O, Kung AL, Knapp S, Bradner JE. 2010. Selective inhibition of BET bromodomains. Nature 468:1067–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Frangogiannis N. 2020. Transforming growth factor-β in tissue fibrosis. J Exp Med 217:e20190103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Freeman TA, Parvizi J, Della Valle CJ, Steinbeck MJ. 2009. Reactive oxygen and nitrogen species induce protein and DNA modifications driving arthrofibrosis following total knee arthroplasty. Fibrogenesis Tissue Repair 2:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fu R, Zu SJ, Liu YJ, Li JC, Dang WZ, Liao LP, Liu LP, Chen PY, Huang HM, Wu KH, Zhou B, Pan Q, Luo C, Zhang YY, Li GM. 2022. Selective bromodomain and extra-terminal bromodomain inhibitor inactivates macrophages and hepatic stellate cells to inhibit liver inflammation and fibrosis. Bioengineered 13:10914–10930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gibney ER, Nolan CM. 2010. Epigenetics and gene expression. Heredity (Edinb) 105:4–13. [DOI] [PubMed] [Google Scholar]
- Grunstein M. 1997. Histone acetylation in chromatin structure and transcription. Nature 389:349–52. [DOI] [PubMed] [Google Scholar]
- Guerrero-Martínez JA, Ceballos-Chávez M, Koehler F, Peiró S, Reyes JC. 2020. TGFβ promotes widespread enhancer chromatin opening and operates on genomic regulatory domains. Nat Commun 11:6196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Houzelstein D, Bullock SL, Lynch DE, Grigorieva EF, Wilson VA, Beddington RS. 2002. Growth and early postimplantation defects in mice deficient for the bromodomain-containing protein Brd4. Mol Cell Biol 22:3794–802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ibrahim IO, Nazarian A, Rodriguez EK. 2020. Clinical Management of Arthrofibrosis: State of the Art and Therapeutic Outlook. JBJS Rev 8:e1900223. [DOI] [PubMed] [Google Scholar]
- Jiang Y, Zhu L, Zhang T, Lu H, Wang C, Xue B, Xu X, Liu Y, Cai Z, Sang W, Hua Y, Ma J. 2017. BRD4 has dual effects on the HMGB1 and NF-κB signalling pathways and is a potential therapeutic target for osteoarthritis. Biochim Biophys Acta Mol Basis Dis 1863:3001–3015. [DOI] [PubMed] [Google Scholar]
- Jin HS, Kim J, Kwak W, Jeong H, Lim GB, Lee CG. 2017. Identification of a Novel Mutation in BRD4 that Causes Autosomal Dominant Syndromic Congenital Cataracts Associated with Other Neuro-Skeletal Anomalies. PLoS One 12:e0169226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaneshita S, Kida T, Yoshioka M, Nishioka K, Raje M, Sakashita A, Hirano A, Sagawa T, Kasahara A, Inoue T, Fujioka K, Nagahara H, Wada M, Kohno M, Strovel JW, Fletcher S, Ashihara E, Kawahito Y. 2021. CG223, a novel BET inhibitor, exerts TGF-β1-mediated antifibrotic effects in a murine model of bleomycin-induced pulmonary fibrosis. Pulm Pharmacol Ther 70:102057. [DOI] [PubMed] [Google Scholar]
- Kato M, Dang V, Wang M, Park JT, Deshpande S, Kadam S, Mardiros A, Zhan Y, Oettgen P, Putta S, Yuan H, Lanting L, Natarajan R. 2013. TGF-β induces acetylation of chromatin and of Ets-1 to alleviate repression of miR-192 in diabetic nephropathy. Sci Signal 6:ra43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim KK, Sheppard D, Chapman HA. 2018. TGF-β1 Signaling and Tissue Fibrosis. Cold Spring Harb Perspect Biol 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee JE, Park YK, Park S, Jang Y, Waring N, Dey A, Ozato K, Lai B, Peng W, Ge K. 2017. Brd4 binds to active enhancers to control cell identity gene induction in adipogenesis and myogenesis. Nat Commun 8:2217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Limberg AK, Tibbo ME, Salib CG, McLaury AR, Turner TW, Berry CE, Jay AG, Carter JM, Bolon B, Berry DJ, Morrey ME, Sanchez-Sotelo J, van Wijnen AJ, Abdel MP. 2020. Reduction of arthrofibrosis utilizing a collagen membrane drug-eluting scaffold with celecoxib and subcutaneous injections with ketotifen. J Orthop Res 38:2474–2483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu CS, Rioja I, Bakr A, Veldwijk MR, Sperk E, Herskind C, Weichenhan D, Prinjha RK, Plass C, Schmezer P, Popanda O. 2022. Selective inhibitors of bromodomain BD1 and BD2 of BET proteins modulate radiation-induced profibrotic fibroblast responses. Int J Cancer 151:275–286. [DOI] [PubMed] [Google Scholar]
- Losina E, Walensky RP, Kessler CL, Emrani PS, Reichmann WM, Wright EA, Holt HL, Solomon DH, Yelin E, Paltiel AD, Katz JN. 2009. Cost-effectiveness of total knee arthroplasty in the United States: patient risk and hospital volume. Arch Intern Med 169:1113–21; discussion 1121–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mannaerts I, Nuytten NR, Rogiers V, Vanderkerken K, van Grunsven LA, Geerts A. 2010. Chronic administration of valproic acid inhibits activation of mouse hepatic stellate cells in vitro and in vivo. Hepatology 51:603–14. [DOI] [PubMed] [Google Scholar]
- Meng XM, Nikolic-Paterson DJ, Lan HY. 2016. TGF-β: the master regulator of fibrosis. Nat Rev Nephrol 12:325–38. [DOI] [PubMed] [Google Scholar]
- Middleton SA, Rajpal N, Cutler L, Mander P, Rioja I, Prinjha RK, Rajpal D, Agarwal P, Kumar V. 2018. BET Inhibition Improves NASH and Liver Fibrosis. Sci Rep 8:17257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morrey ME, Abdel MP, Riester SM, Dudakovic A, van Wijnen AJ, Morrey BF, Sanchez-Sotelo J. 2017. Molecular landscape of arthrofibrosis: Microarray and bioinformatic analysis of the temporal expression of 380 genes during contracture genesis. Gene 610:15–23. [DOI] [PubMed] [Google Scholar]
- Najafova Z, Tirado-Magallanes R, Subramaniam M, Hossan T, Schmidt G, Nagarajan S, Baumgart SJ, Mishra VK, Bedi U, Hesse E, Knapp S, Hawse JR, Johnsen SA. 2017. BRD4 localization to lineage-specific enhancers is associated with a distinct transcription factor repertoire. Nucleic Acids Res 45:127–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nesterenko S, Morrey ME, Abdel MP, An KN, Steinmann SP, Morrey BF, Sanchez-Sotelo J. 2009. New rabbit knee model of posttraumatic joint contracture: indirect capsular damage induces a severe contracture. J Orthop Res 27:1028–32. [DOI] [PubMed] [Google Scholar]
- O’Reilly S. 2017. Epigenetics in fibrosis. Mol Aspects Med 54:89–102. [DOI] [PubMed] [Google Scholar]
- Ota C, Yamada M, Fujino N, Motohashi H, Tando Y, Takei Y, Suzuki T, Takahashi T, Kamata S, Makiguchi T, Yamaya M, Kubo H. 2015. Histone deacetylase inhibitor restores surfactant protein-C expression in alveolar-epithelial type II cells and attenuates bleomycin-induced pulmonary fibrosis in vivo. Exp Lung Res 41:422–34. [DOI] [PubMed] [Google Scholar]
- Owen AR, Dagneaux L, Limberg AK, Bettencourt JW, Bayram B, Bolon B, Berry DJ, Morrey ME, Sanchez-Sotelo J, van Wijnen AJ, Abdel MP. 2022. Biomechanical, histological, and molecular characterization of a new posttraumatic model of arthrofibrosis in rats. J Orthop Res 40:323–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paradise CR, De La Vega RE, Galvan ML, Carrasco ME, Thaler R, van Wijnen AJ, Dudakovic A. 2021. Brd4 Inactivation Increases Adenoviral Delivery of BMP2 for Paracrine Stimulation of Osteogenic Differentiation as a Gene Therapeutic Concept to Enhance Bone Healing. JBMR Plus 5:e10520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paradise CR, Galvan ML, Kubrova E, Bowden S, Liu E, Carstens MF, Thaler R, Stein GS, van Wijnen AJ, Dudakovic A. 2020. The epigenetic reader Brd4 is required for osteoblast differentiation. J Cell Physiol 235:5293–5304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paradise CR, Galvan ML, Pichurin O, Jerez S, Kubrova E, Dehghani SS, Carrasco ME, Thaler R, Larson AN, van Wijnen AJ, Dudakovic A. 2022. Brd4 is required for chondrocyte differentiation and endochondral ossification. Bone 154:116234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rani A, Chin C, Bremner R, Mohanakumar T, Angara S. 2021. Targeting chromatin dysregulation in organ fibrosis. Cytokine Growth Factor Rev 57:64–72. [DOI] [PubMed] [Google Scholar]
- Sabari BR, Zhang D, Allis CD, Zhao Y. 2017. Metabolic regulation of gene expression through histone acylations. Nat Rev Mol Cell Biol 18:90–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Salib CG, Reina N, Trousdale WH, Limberg AK, Tibbo ME, Jay AG, Robin JX, Turner TW, Jones CR, Paradise CR, Lewallen EA, Bolon B, Carter JM, Berry DJ, Morrey ME, Sanchez-Sotelo J, van Wijnen AJ, Abdel MP. 2019. Inhibition of COX-2 Pathway as a Potential Prophylaxis Against Arthrofibrogenesis in a Rabbit Model of Joint Contracture. J Orthop Res 37:2609–2620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sanchez R, Zhou MM. 2009. The role of human bromodomains in chromatin biology and gene transcription. Curr Opin Drug Discov Devel 12:659–65. [PMC free article] [PubMed] [Google Scholar]
- Schairer WW, Vail TP, Bozic KJ. 2014. What are the rates and causes of hospital readmission after total knee arthroplasty? Clin Orthop Relat Res 472:181–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schroer WC, Berend KR, Lombardi AV, Barnes CL, Bolognesi MP, Berend ME, Ritter MA, Nunley RM. 2013. Why are total knees failing today? Etiology of total knee revision in 2010 and 2011. J Arthroplasty 28:116–9. [DOI] [PubMed] [Google Scholar]
- Shimada N. 1973. [Human placental lactogen]. Josanpu Zasshi 27:58. [PubMed] [Google Scholar]
- Smith ER, Wigg B, Holt S, Hewitson TD. 2019. TGF-β1 modifies histone acetylation and acetyl-coenzyme A metabolism in renal myofibroblasts. Am J Physiol Renal Physiol 316:F517–F529. [DOI] [PubMed] [Google Scholar]
- Stathis A, Bertoni F. 2018. BET Proteins as Targets for Anticancer Treatment. Cancer Discov 8:24–36. [DOI] [PubMed] [Google Scholar]
- Steplewski A, Fertala J, Beredjiklian PK, Abboud JA, Wang ML, Namdari S, Barlow J, Rivlin M, Arnold WV, Kostas J, Hou C, Fertala A. 2016. Auxiliary proteins that facilitate formation of collagen-rich deposits in the posterior knee capsule in a rabbit-based joint contracture model. J Orthop Res 34:489–501. [DOI] [PubMed] [Google Scholar]
- Stratton MS, Bagchi RA, Felisbino MB, Hirsch RA, Smith HE, Riching AS, Enyart BY, Koch KA, Cavasin MA, Alexanian M, Song K, Qi J, Lemieux ME, Srivastava D, Lam MPY, Haldar SM, Lin CY, McKinsey TA. 2019. Dynamic Chromatin Targeting of BRD4 Stimulates Cardiac Fibroblast Activation. Circ Res 125:662–677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun G, Reddy MA, Yuan H, Lanting L, Kato M, Natarajan R. 2010. Epigenetic histone methylation modulates fibrotic gene expression. J Am Soc Nephrol 21:2069–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Svegliati S, Marrone G, Pezone A, Spadoni T, Grieco A, Moroncini G, Grieco D, Vinciguerra M, Agnese S, Jüngel A, Distler O, Musti AM, Gabrielli A, Avvedimento EV. 2014. Oxidative DNA damage induces the ATM-mediated transcriptional suppression of the Wnt inhibitor WIF-1 in systemic sclerosis and fibrosis. Sci Signal 7:ra84. [DOI] [PubMed] [Google Scholar]
- Tang X, Peng R, Phillips JE, Deguzman J, Ren Y, Apparsundaram S, Luo Q, Bauer CM, Fuentes ME, DeMartino JA, Tyagi G, Garrido R, Hogaboam CM, Denton CP, Holmes AM, Kitson C, Stevenson CS, Budd DC. 2013a. Assessment of Brd4 inhibition in idiopathic pulmonary fibrosis lung fibroblasts and in vivo models of lung fibrosis. Am J Pathol 183:470–9. [DOI] [PubMed] [Google Scholar]
- Tang X, Peng R, Ren Y, Apparsundaram S, Deguzman J, Bauer CM, Hoffman AF, Hamilton S, Liang Z, Zeng H, Fuentes ME, Demartino JA, Kitson C, Stevenson CS, Budd DC. 2013b. BET bromodomain proteins mediate downstream signaling events following growth factor stimulation in human lung fibroblasts and are involved in bleomycin-induced pulmonary fibrosis. Mol Pharmacol 83:283–93. [DOI] [PubMed] [Google Scholar]
- Taniguchi Y. 2016. The Bromodomain and Extra-Terminal Domain (BET) Family: Functional Anatomy of BET Paralogous Proteins. Int J Mol Sci 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tibbo ME, Limberg AK, Salib CG, Ahmed AT, van Wijnen AJ, Berry DJ, Abdel MP. 2019. Acquired Idiopathic Stiffness After Total Knee Arthroplasty: A Systematic Review and Meta-Analysis. J Bone Joint Surg Am 101:1320–1330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trousdale WH, Limberg AK, Reina N, Salib CG, Thaler R, Dudakovic A, Berry DJ, Morrey ME, Sanchez-Sotelo J, van Wijnen A, Abdel MP. 2022. Intra-articular celecoxib improves knee extension regardless of surgical release in a rabbit model of arthrofibrosis. Bone Joint Res 11:32–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tschumperlin DJ, Ligresti G, Hilscher MB, Shah VH. 2018. Mechanosensing and fibrosis. J Clin Invest 128:74–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van Beneden K, Geers C, Pauwels M, Mannaerts I, Wissing KM, Van den Branden C, van Grunsven LA. 2013. Comparison of trichostatin A and valproic acid treatment regimens in a mouse model of kidney fibrosis. Toxicol Appl Pharmacol 271:276–84. [DOI] [PubMed] [Google Scholar]
- van Wijnen AJ, Westendorf JJ. 2019. Epigenetics as a New Frontier in Orthopedic Regenerative Medicine and Oncology. J Orthop Res 37:1465–1474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vichaikul S, Gurrea-Rubio M, Amin MA, Campbell PL, Wu Q, Mattichak MN, Brodie WD, Palisoc PJ, Ali M, Muraoka S, Ruth JH, Model EN, Rohraff DM, Hervoso JL, Mao-Draayer Y, Fox DA, Khanna D, Sawalha AH, Tsou PS. 2022. Inhibition of bromodomain extraterminal histone readers alleviates skin fibrosis in experimental models of scleroderma. JCI Insight 7:e150871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang J, Zhou F, Li Z, Mei H, Wang Y, Ma H, Shi L, Huang A, Zhang T, Lin Z, Wu G. 2018. Pharmacological targeting of BET proteins attenuates radiation-induced lung fibrosis. Sci Rep 8:998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilflingseder J, Willi M, Lee HK, Olauson H, Jankowski J, Ichimura T, Erben R, Valerius MT, Hennighausen L, Bonventre JV. 2020. Enhancer and super-enhancer dynamics in repair after ischemic acute kidney injury. Nat Commun 11:3383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams LM, McCann FE, Cabrita MA, Layton T, Cribbs A, Knezevic B, Fang H, Knight J, Zhang M, Fischer R, Bonham S, Steenbeek LM, Yang N, Sood M, Bainbridge C, Warwick D, Harry L, Davidson D, Xie W, Sundstrӧm M, Feldmann M, Nanchahal J. 2020. Identifying collagen VI as a target of fibrotic diseases regulated by CREBBP/EP300. Proc Natl Acad Sci U S A 117:20753–20763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiong C, Masucci MV, Zhou X, Liu N, Zang X, Tolbert E, Zhao TC, Zhuang S. 2016. Pharmacological targeting of BET proteins inhibits renal fibroblast activation and alleviates renal fibrosis. Oncotarget 7:69291–69308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yuan H, Reddy MA, Sun G, Lanting L, Wang M, Kato M, Natarajan R. 2013. Involvement of p300/CBP and epigenetic histone acetylation in TGF-β1-mediated gene transcription in mesangial cells. Am J Physiol Renal Physiol 304:F601–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zehender A, Li YN, Lin NY, Stefanica A, Nüchel J, Chen CW, Hsu HH, Zhu H, Ding X, Huang J, Shen L, Györfi AH, Soare A, Rauber S, Bergmann C, Ramming A, Plomann M, Eckes B, Schett G, Distler JHW. 2021. TGFβ promotes fibrosis by MYST1-dependent epigenetic regulation of autophagy. Nat Commun 12:4404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang X, Liu H, Hock T, Thannickal VJ, Sanders YY. 2013. Histone deacetylase inhibition downregulates collagen 3A1 in fibrotic lung fibroblasts. Int J Mol Sci 14:19605–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou B, Mu J, Gong Y, Lu C, Zhao Y, He T, Qin Z. 2017. Brd4 inhibition attenuates unilateral ureteral obstruction-induced fibrosis by blocking TGF-β-mediated Nox4 expression. Redox Biol 11:390–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu W, Wu RD, Lv YG, Liu YM, Huang H, Xu JQ. 2020. BRD4 blockage alleviates pathological cardiac hypertrophy through the suppression of fibrosis and inflammation via reducing ROS generation. Biomed Pharmacother 121:109368. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Datasets utilized in this study are archived in the Gene Expression Omnibus of the National Institute for Biotechnology Information (GSE185333).







