|
Sato et al. 10.1073/pnas.0408666102. |
Fig. 5. Coexistence of parental pathogenic mutated mtDNAs within hybrid cells and its effect on phenotypic expression of mitochondrial respiratory function. r + 143B, 143BTK– cells; r + HeLa, HeLa cells; r 0 143B, mtDNA-less 143BTK– cells; r 0 HeLa, mtDNA-less HeLa cells; syn– HeLa and syn– 143B are respiration-deficient HeLa cells and 143BTK– cells due to A4269G and A3243G pathogenic mutations in the tRNAIle gene and tRNALeu(UUR)gene, respectively. The syn– cells were used as parental cells for isolation of their hybrid cells (syn– 143B ´ syn– HeLa). 9m represents the cultivation time (months) of the hybrid cells after fusion. (A) Analyses of mtDNA genotypes of parental cells and their hybrid cells. For identification of the mutated A3243G mtDNA (3243+) and A4269G mtDNA (4269+), we carried out restriction enzyme analyses of the PCR products (see Materials and Methods). Hybrid cells show the coexistence of parental A3243G mtDNA (3243+) and A4269G mtDNA (4269+). (B) Analysis of phenotype of mitochondrial translation activity. After specific [35S]-methionine labeling of mitochondrial translation products, mitochondrial proteins were separated by SDS/PAGE. ND5, COI, ND4, Cytb, ND2, ND1, COII, COIII, ATP6, ND6, ND3, ND3', ATP8, and ND4L are polypeptides encoded by mtDNA genes. No activities were observed in r 0 HeLa and r 0 143B because of their mtDNA depletion, and in syn– HeLa and syn– 143B because of pathogenic mutations in tRNA genes. Hybrid cells showed restored mitochondrial translation activities. (C) Analysis of phenotype of respiratory enzyme activity. Examination of enzyme activity of cytochrome c oxidase (COX) (complex IV), one of the respiratory enzyme complexes. No cells without mitochondrial translation activity showed COX activity, whereas hybrid cells showed restoration of the COX activity reduced in their parental syn– cells.
Fig. 6. Sequence analysis of cloned PCR fragments from hybrid cells carrying parental A3243G and A4269G mtDNAs. (A) Polymorphisms in PCR fragments of A3243G and A4269G mtDNAs. Cambridge reference sequences (CRS) shown in the yellow lane were used as a human mtDNA standard for comparison with the two parental mtDNA sequences. The A3243G 1–10, shown in the pink lane, represents the sequence of 10 clones of the PCR products amplified from A3243G mtDNA. The A4269G 1–10, shown in the blue lane, represents the sequence of 10 clones of the PCR products amplified from A4269G mtDNA. The results on the sequences of the cloned 4,878-bp PCR products showed that 20 sites in 4,878-bp sequences are different from that of CRS. Polymorphic mutation sites specific to A3243G mtDNA or A4269G mtDNA are shown by black lines and letters. Pathogenic mutation sites, A4269G and A3243G, are shown by red lines and letters. (B) Sequences of the cloned 4,878-bp PCR products of mtDNAs from the hybrid cells carrying parental A3243G and A4269G mtDNAs. As a reference, 18 sites of CRS that are specific to either A4269G or A3243G mtDNA are shown in the yellow lane. Mutation sites specific to A3243G mtDNA are shown in pink, and those specific to A4269G mtDNA are shown in blue. Of 100 clones sequenced, 15 clones (clones 1–15) and 21 clones (clones 80–100) possessed sequences completely identical to those of parental A3243G and A4269G mtDNAs, respectively. However, the other 64 clones (clones 16–79) were apparent recombinants because of mutations derived from different parental mtDNAs. We observed 35 somatic mutations specific to each clone (data not shown).
Fig. 7. Sequence analysis of purified mtDNA from hybrid cells carrying parental A3243G and A4269G mtDNAs. Sequences of the cloned mtDNA fragments, fragments A, B, and C (see Fig. 2). CRS shown in the yellow lane is used as a human mtDNA standard for comparison with both parental mtDNA sequences. Pink and blue lanes represent the sequences of A3243G mtDNA and A4269G mtDNAs, respectively, purified from parental cells.
Fig. 8. Sequence analysis of D mtDNA purified from brain of an F3 mito-mouse.
Sequences of the cloned D mtDNA purified from brain of an F3 mito-mouse possessing 34.2% D mtDNA. None of 108 clones of D mtDNA from brain show recombination, whereas 4 clones (clones 1–4) possess somatic mutations.
Fig. 9. Detection of a recombinant mtDNA molecule in the original skeletal muscle sample. (A) Gene map of clones 17 and 18 and nucleotide sequence (np 4,141–4,311) around a recombination break point. Polymorphic mutations specific to Mus spretus and M. musculus domesticus mtDNAs are shown by green and red letters, respectively. Green and red arrows indicate primers specific to M. spretus and M. m. domesticus mtDNAs, respectively, used for selective amplification of the recombinants. (B) Selective amplification of the recombinants. M. m. domesticus mtDNA, purified mtDNA from liver of a B6 strain mouse; M. spretus mtDNA, purified mtDNA from liver of a B6mtspr strain mouse; mixture, mixture of M. spretus and M. m. domesticus mtDNAs; mito-mouse, purified mtDNA from skeletal muscles, liver, kidney, and brain of an F3 mito-mouse. Fragments of 171 bp correspond to the recombinants. (C) Sequences of cloned 171-bp fragments. Red and green regions correspond to sequences of M. m. domesticus and M. spretus mtDNAs, respectively.
Fig. 10. Sequence analysis of NZB mtDNA purified from skeletal muscles of an F3 NZB/B6 mouse. Sequences of the cloned NZB mtDNA purified from skeletal muscles possessing 24.0% NZB mtDNA. Orange and red regions correspond to sequences of NZB mtDNA and B6 mtDNA, respectively. Although there are 90 polymorphic sites between NZB and B6 mtDNA, all of the sequenced NZB mtDNAs did not possessed the sites specific to the B6 mtDNA. Of 114 clones, 96 clones showed identical sequences to those of NZB mtDNA except for two polymorphic mutations (np 14,180 and 14,357), whereas 18 clones (clones 1–18) possessed somatic mutations.
Supporting Materials and Methods
Cloning of Purified Human and Mouse mtDNAs. Human mtDNA purified from hybrid cells was digested with SacI, EcoRI, and EcoRV. After agarose gel electrophoresis, three mtDNA fragments, fragment A [4,083 bp; nucleotide position (np) 41-4,123], fragment B, (3,556 bp; np 3,183-6,738), and fragment C (2,994 bp; np 9,649-12,642) possessing SacI and EcoRI sites, EcoRV sites, and SacI and EcoRI sites, respectively, were extracted from the gels and ligated with pBluescript II SK
– and pUC118 (Takara, Tokyo). The ligated vectors were introduced into DH5a and DH10B (Takara).Mouse mtDNA purified from skeletal muscles and brain of a mito-mouse was digested with MluI. Mus musculus domesticus mtDNA was digested at np 1,772, but M. spretus mtDNA was not due to the lack of MluI sites. After agarose gel electrophoresis, an 11.6-kbp fragment corresponding to whole D mtDNA was extracted from the gel and ligated with pCR-XL-TOPO vector (Invitrogen), possessing an 87-bp insertion (TAAGTTAGAGACCTTAAAATCTCCATACACCATGATGCCACAACTAGATACATAACATGATTTATCACA) at the TA cloning site and then introduced into JM109 (Takara).
Mouse mtDNA purified from skeletal muscles of an NZB/B6 mouse was digested with MluI. Both NZB and B6 mtDNAs were digested at np 1,772, and the fragments were introduced into JM109 by the same methods as mentioned above.