Fungi Entrophosporales Pseudoentrophosporaceae TedersooLehoMagurnoFrancoAlkahtaniSaadMikryukovVladimirPhylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes)MycoKeys0908202410727332510.3897/mycokeys.107.125549 3EF89F07-3237-56C3-AB4B-37AEDC4F9360 Pseudoentrophospora kesseensis 853566 Tedersoo & Magurnosp. nov.Diagnosis.

Differs from other species of Pseudoentrophospora and Entrophospora based on the ITS region (ITS2 positions 127–146 gaaccgcaaattacgcatta, one mismatch allowed) and LSU (positions 486–515 gaacaggtcaacatcaattcttattgccat, one mismatch allowed) as indicated in Fig. 3.

10.3897/mycokeys.107.125549.figure313293563551B41D5-BC3C-501A-BA3E-ADD0A7C86B2C

Diagnostic barcodes for Pseudoentrophosporakesseensis relative to closely-related taxa in ITS2 and LSU.

https://binary.pensoft.net/fig/1111390
Type.

Soil eDNA sample TUE101916 (holotype); eDNA sequence EUK1631429 (lectotype); GSMc plot G4940, coppiced Juniperus-Acer woodland (soil sample TUE001916) in Kesse Island, Estonia, 58.63443°N, 23.43938°E.

Description.

Other eDNA sequences EUK1636430–EUK1636432 from the type locality.

Etymology.

pseudo (Greek) = false; Entrophospora (Latin) refers to a related fungal genus; and kesseensis (Latin) indicates locality of the type species. The name depicts phylogenetic relatedness to Entrophosphora and the only locality where the type species has been recorded.

Notes.

Found from a single site, with ITS and LSU sequences differing up to 0.5% and 1%, respectively. The ITS1 subregion harbours only 58 bases, being amongst the shortest across fungi (excl. microsporidians).