Separation from other species of Kahvena based on the ITS region (ITS2 positions 200–218 cattcgcaggaatagccag; one mismatch allowed) and from other species of Endogonomycetes based on LSU (positions 653–683 acgcaagctccagatcgaatctccgggctaa; one mismatch allowed) as indicated in Fig. 5.

Soil eDNA sample TUE100738 (holotype); eDNA sequence EUK1634339 (lectotype); GSMc plot G4196, Populus-Picea-Pinus forest (soil sample TUE000738) in Kahvena, Estonia (58.27991°N, 25.23165°E).

Other sequences: EUK1635883–EUK1635886 (type locality); EUK1631811 (GSMc plot G2767, mixed woodland soil at Mäebe, Estonia, 58.30937°N, 22.07618°E); KF618358 (Piceamariana forest soil, AK, USA); MT596306 (Tobiotsuka Kofun, Japan, 34.6355°N, 133.6814°E); KU062529 (unknown source); and KF565426 (Duke Forest, NC, USA, 35.97°N, -79.09°E), isolated by Rebecca C. Mueller (Mueller et al. 2014).

Kahvena (Estonian) refers to type locality; and Rebecca (English) refers to the first name of Rebecca C. Mueller, who collected the first materials belonging to this genus and the type species.

Found from temperate and subarctic forests in Europe, Asia and North America, with ITS and LSU sequences differing up to 4% (excluding a 29-base deletion in EUK1631811 and KU062529) and 1.5%, respectively. Considered as a single species because of high intraspecific variation amongst common sequence variants in the type locality (2% in ITS and 1% in LSU, representing both indels and substitutions).