Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9.

Soil eDNA sample TUE103095 (holotype); type sequence EUK1603180 (lectotype); GSMc plot S590, Populustremula forest (soil sample TUE003095) in Lehetu, Estonia, 59.01857°N, 24.28041°E.

Other sequences: EUK1603180 (type locality); EUK1602367 (LSU only; type locality; also found in 50 other sites in Estonia); EUK1634481 (GSMc plot G4195, Quercusrobur woodland soil in Lustivere, Estonia, 58.66293°N, 26.08465°E); EUK1603818 (GSMc plot G5824, managed grassland soil in Kuremaa, Estonia, 58.74138°N, 26.52727°E); EUK1603131 (GSMc plot G4105, Piceaabies forest soil in Lepa, Estonia, 57.70158°N, 26.23993°E); EUK0021956 (GSMc plot G5150, subarctic grassland soil in Kokelv, Norway, 70.61116°N, 24.62483°E); and EUK0023592 (GSMc plot S035, mixed deciduous forest soil in Kedrovaya Pad, Russia, 43.10834°N, 131.55447°E).

Lehetu (Estonian) refers to type locality (also meaning “leafless”); and Indrek (Estonian) refers to the first name of Indrek Hiiesalu who collected materials from the type locality.

Found in Baltic States, Scandinavia and Russia, with ITS and LSU sequences differing up to 3.5% and 0.2%, respectively. Seems to be a generalist in terms of habitat type and soil pH; so far, not found from roots.