Separation from other species of Parnigua based on the ITS region (positions 51–80 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 444–463 ggcgggaaatcagcccccct; no mismatch allowed) as indicated in Fig. 13.

Soil eDNA sample TUE102228 (holotype); type sequence: EUK1635261 (lectotype); GSMc plot G5251, Quercusrobur woodland (soil sample TUE002228) in Parnigu, Estonia, 58.64096°N, 26.38468°E.

Other sequences: EUK1635874 (GSMc plot G4499, calcareous Piceaabies forest soil in Kurisoo, Estonia; 59.12808°N, 25.76395°E); EUK1635875 (GSMc plot G4746, Betulapendula forest soil in Karjamõisa, Estonia, 57.59761°N, 26.35493°E); EUK1635878 (GSMc plot G4794, Ulmus-Fraxinus forest soil in Lõhtsuu, Estonia, 57.91781°N, 26.52069°E); EUK1603328 (GSMc plot G4167, Salixpentandra peat soil in Tammispää, Estonia, 58.92051°N, 27.01118°E); EUK1602985 (GSMc plot G5923, Malusdomestica orchard soil in Kalnabeites, Latvia, 57.1333°N, 24.8566°E); OU939710 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E); and MH625006 (grassland soil in Wakanui, New Zealand, -43.668°N, 172.470°E), first isolated by Craig R. Anderson (Anderson et al. 2018).

Parnigu (Estonian) refers to type locality; and Craig (English) refers to the first name of Craig R. Anderson who was the first to record this species.

Found from Estonia, Sweden and New Zealand, with ITS and LSU sequences differing up to 0.5%. Found in all croplands, grasslands, deciduous and coniferous forests.