Fungi Riederbergales Riederbergaceae TedersooLehoMagurnoFrancoAlkahtaniSaadMikryukovVladimirPhylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes)MycoKeys0908202410727332510.3897/mycokeys.107.125549 9E7F08B8-4B5F-5D4A-A6FD-E53BEF71D3D8 Riederberga sylviae 853615 Tedersoosp. nov.Diagnosis.

Separation from other species of Riederberga based on the ITS region (ITS2 positions 186–215 gctttggacggcatgcgaatctgcatcaca; one mismatch allowed) and LSU (positions 656–685 tcaccaatcgacgtcaatcggcatgcgtct; one mismatch allowed) as indicated in Fig. 14.

10.3897/mycokeys.107.125549.figure141329355380F370C0-9CCF-599D-82CD-9DF163E2694F

Diagnostic barcodes for Riederbergasylviae relative to closely-related taxa in ITS2 and LSU.

https://binary.pensoft.net/fig/1111401Type.

Soil eDNA sample TUE128372 (holotype); eDNA sequence: EUK1602903 (lectotype); GSMc plot G5783, wet grassland (soil sample TUE028372) in Altnurga, Estonia, 58.55682°N, 26.29259°E.

Description.

Other sequences: EUK1604046 and EUK1604047 (both type locality); and GU055683 (ITS part considered; managed grassland soil in Riederberg, Austria, 48.25°N, 16.07°E), collected by Sylvia Klaubauf (Klaubauf et al. 2010).

Etymology.

Riederberg (German) refers to type locality; and Sylvia (German) refers to the first name of Sylvia Klaubauf, who first collected the materials of type species and the entire order from the type habitat.

Notes.

Found in Austria and Estonia, with ITS and LSU sequences displaying up to 1% differences.

KlaubaufSInselbacherEZechmeister-BoltensternSWanckWGottsbergerRStraussJGorferM (2010) Molecular diversity of fungal communities in agricultural soils from lower Austria.Fungal Diversity44(1): 65–75. https://doi.org/10.1007/s13225-010-0053-1