Inhibition of protein kinase CK2 prevents the progression of glomerulonephritis -- Yamada et al. 102 (21): 7736 Data Supplement - HTML Page - index.htslp -- Proceedings of the National Academy of Sciences

PNAS Yamada et al. 10.1073/pnas.0409818102.

Supporting Information

Files in this Data Supplement:

Supporting Table 1
Supporting Table 2
Supporting Figure 5

Supporting Figure 5 Fig. 5.
Specificity of emodin. Specificity of inhibitory activity of 10 mM emodin against protein kinases in vitro. Extracellular signal-regulated kinase (ERK) activity was assayed by using the ERK assay kit. The value for total enzyme activity was 230 nmol per min per mg of protein. p38-regulated/activated kinase (p38) activity was assayed by using the p38alpha assay kit. The value for total enzyme activity was 75 nmol per min per milligram of protein. S6 kinase (S6K) activity was assayed by using the p70 S6 kinase assay kit. The value for total enzyme activity was 16.4 pmol per min per mg of protein. cAMP-dependent protein kinase (PKA) activity was assayed by using the PKA assay kit. The value for total enzyme activity was 8.9 mmol per min per mg of protein. Protein kinase C (PKC) activity was assayed by using the PKC assay kit. The value for total enzyme activity was 13.8 mmol per min per mg of protein. c-Src kinase (Src) activity was assayed by using the Src assay kit. The value for total enzyme activity was 439 nmol per min per mg of protein. All assay kits were purchased from Upstate Biotechnology. These kinase activities were assayed according to the manufacturer’s instructions.

Table 1. Sequences of PCR primers

Gene	Sequences
	Forward	Reverse
Osteopontin	acacaagcagacgttttgac	actgggatgaccttgatagc
CK2 a	acatcatcacacttgcagac	gcaactcggacattatactc
TGF b-stimulated clone 22	acgcttccgtgagacttgac	tccacttcctctctaactgc
TGF b1	agtggctgtcttttgacgtc	ctgtcacaagagcagtgagc
RhoB	ccgtgttcgagaactatgtg	acataaggatgacgtcggtg
Cathepsin D	aacagtgacaagtccagcac	aacttggctgcgatgaatac
Collagen IV a1	ggtgtcaaaggagaagcagg	cctttgtctcctttggtgcc
c-fos	gttccttctatgcagcagac	cagtataggtagtgcagctg
Egr-1	ccttcgctcactccactatc	taaggtggtcactacgactg
Elk-1	gctgaacaagaagtctcacc	agtgctccagaaatggatgc
TNF a	tccctctcatcagttccatg	tgggagtagataaggtacag
MCP-1	agagagagatctgtgctgac	cacattcaaaggtgctgaag
Fibronectin	cgaccgatgccaagattcag	taggtctccacctgagaatg
Connective tissue growth factor	ccgactggaagacacatttg	ccagcctgcagaaggtattg
Platelet-derived growth factor B	gagctggacttgaacatgac	aagttggcattggtgcgatc
G3PDH	tccgttgtggatctgacatg	ggagttgctgttgaagtcac

The PCR conditions were 40 cycles of the following protocol: 10 s denaturation at 95°C and 20 s annealing at 58°C, followed by 20 s extension at 72°C.

Table 2. Genes differentially expressed in anti-GBM GN or prednisolone-treated GN rats

GeneBank Accession no.	Gene		A	B	C
					Anti-GBM	+Prednisolone
M14656	Osteopontin		17.0	¯	32.3 ± 1.5**	15.9 ± 3.1##
L15618	CK2 a		4.7	¯	2.6 ± 0.0**	1.5 ± 0.3##
L12459	Lysozyme		4.3	¾
L25785	TGF b-stimulated clone 22		4.0	¯	6.0 ± 0.2**	3.9 ± 0.2##
U41341	Calgizzarin		3.9	¯
NM_013043	TGF- b1		3.8	¯	6.8 ± 0.2**	3.8 ± 0.5##
AJ223812	Caldesmon		3.6	¯
Y00441	b 2-microglobulin		3.4	¯
M74295	RhoB		3.3	¯	6.4 ± 0.4**	4.2 ± 0.8#
X54467	Cathepsin D		3.3	¯	6.0 ± 0.6**	3.6 ± 0.1##
X63535	Ufo		2.8	¯
Z11663	CD24 antigen		2.7	¯
AL121748	Neuropilin 1		2.7	¾
X92439	Collagen IV a1		2.5	¯	6.1 ± 0.5**	3.8 ± 0.2#
X63561	Elongation factor 1 a		2.4	¯
NM_010884	N-myc downstream-regulated 1		2.4	¯
AF121213	Methionine synthase reductase		2.4	¾
Z31721	Myosin II		2.2	¯
AL117694	a -Actinin		2.2	¯
AF178845	Calmodulin		2.2	¾
NM_008774	Poly(A)-binding protein		2.2	¾
M11794	Metallothionein II		2.1	¾
D17614	14-3-3 protein		2.1	¾
U09567	Cysteine-rich protein 1		2.1	¾
X56228	Rhodanese		2.1	¾
X62908	Cofilin		2.0	¯
AF028823	Tax interaction protein 1		2.0	¯
X16957	Cystatin C		2.0	¾
U22893	Y-box protein		2.0	¾
AF053317	Organic anion transporter 1		0.2
U25808	Kidney specific androgen-regulated protein		0.3
X05080	b -globin		0.3	¾
AJ131835	Ste1		0.4	¾
AF167412	Pendrin		0.4
M25073	Zn-peptidase aminopeptidase		0.4	¾
Z50144	Kynurenine/a -aminoadipate aminotransferase		0.4
AF111160	Glutathione S-transferase A3 subunit		0.4
K03248	Phosphoenolpyruvate carboxykinase		0.4	¾
U20984	Iintestinal trefoil factor		0.4	¾
U42719	C4 complement protein		0.4
AF045464	Aaflatoxin B1 aldehyde reductase		0.5	¾
L22191		g -Glutamylcysteine synthetase light subunit	0.5	¾
M93301	Ornithine aminotransferase		0.5

Column A: GN-related gene expression (Anti-GBM/control). Column B: Prednisolone-related gene expression,

; up-regulated, ¯; down-regulated. ¾; unchanged. Column C: Real-time RT-PCR analysis of the differentially expressed genes identified by cDNA microarray analysis in the renal cortex of anti-GBM GN rats on day 28. Data are the mean ± SEM expressed as fold increase over control values; n = 6 animals. **, P < 0.01 compared with the control group. #, P < 0.05; ##, P < 0.01 compared with the anti-GBM group.