Bellosta et al. 10.1073/pnas.0408945102. |
Supporting Figure 4
Supporting Table 3
Supporting Figure 5
Supporting Figure 6
Supporting Figure 7
Supporting Materials and Methods
Supporting Figure 8
Supporting Table 4
Supporting Figure 9
Supporting Figure 10
Supporting Table 5
Supporting Figure 4
Fig. 4.
In vitro interaction between dMyc and Pont/Rept. (A Upper) Lysates of S2 cells expressing A-Rept or M-Pont were incubated with GST alone or GST-dMyc[N]. Proteins bound to beads were visualized by Western blot using anti-AU1 (recognizing A-Rept) or 9E10 antibodies (recognizing M-Pont), respectively; the lane labeled input shows 3% of input lysates. (Lower) Coomassie blue-stained gel showing the amounts of GST and GST-dMyc[N], respectively. (B) The indicated amounts of M-Pont or A-Rept coding plasmids were transfected into S2 cells. (Upper) Whole-cell extracts were incubated with GST-dMyc, and M-Pont and A-Rept bound to beads were visualized by using 9E10 or anti-AU1 antibodies. (Lower) Immunoblots of total cells lysates. (C) Whole extracts from cells expressing M-Pont or A-Rept were incubated with GST-dMyc. Bound proteins were eluted with step-wise increased concentrations of NaCl, and eluates were analyzed by immunoblotting using the indicated antibodies. Lane B indicates the bound material before elution.Fig. 5.
Ectopic expression of dMyc and Pont but not Rept rescues the eye defect of dmP0/Y; pont-/+ flies. Scanning electron micrographs of adult eyes from ey>dmP0/Y;pont-/+ (A–D) or ey>dm+/Y (E–H). In addition, these flies carried the following transgenes: UAS-H-dMyc (B and F), UAS-M-Pont (C and G), UAS-A-Rept (D and H).Fig. 6.
Size defects of dmyc/pont mutant larval imaginal discs. Eye imaginal discs of y w (A), dmP0;+/+ (B) or dmP0; pont-/+ (C) mutants were stained for the neuronal marker ELAV (green), phospho-histone H3 (red) and DAPI (blue). All panels are shown at the same magnification.
Fig. 7.
Apoptosis is not responsible for the eye defect of dmyc/pont mutants. (A and B) Third-instar larval eye imaginal discs stained with acridin orange to reveal apoptotic cells. (A) dmP0/Y;+/+. (B) dmP0/Y;pont-/+. (C–F) Scanning electron micrographs of adult eyes of the genotypes ey>dmP0/Y (C), ey>dmP0/Y; UAS-p35/+ (D), ey>dmP0/Y; pont-/+ (E), ey>dmP0/Y; pont-/+ UAS-p35/+ (F). The graph on the left shows the number of ommatidia in the genotypes shown in C–F (average of five independent eyes); error bars show standard deviation.Fig. 8.
Comparison of transcriptional targets of dMyc, Pont, and Rept in S2 cells. Gene expression changes (relative to gfp–RNA-interference-treated samples) were determined at 48 h after addition of dsRNA against dmyc, pont, or rept to Drosophila S2 cells (see Supporting Materials and Methods). The plots display the logarithm to the base of 2 of these relative changes for all genes that change by a least 1.5-fold relative to control in at least one of the two depicted conditions. mfas is marked in red, and linear regression curves and correlation coefficients are indicated.Fig. 9.
Expression of mfas in eye imaginal discs. mfas levels were determined by quantitative RT-PCR in third-instar larval eye imaginal discs of the indicated four genotypes (see Supporting Materials and Methods). All values are normalized to the expression of tubulin. Actin expression was monitored as an additional control. Blue bars correspond to experiment 1 and red bars to experiment 2, respectively (see Supporting Materials and Methods).Fig. 10.
Binding of dMyc and Pont to the mfas promoter. Chromatin from S2 cells overexpressing H-dMyc was analyzed by chromatin immunoprecipitation in two separate experiments using control antibodies, antibodies against the ectopic H-dMyc (anti-HA), and antiserum against endogenous Pont, respectively. Two separate immunoprecipitations were carried out for control and H-dMyc in experiment 1, and for control and Pont in experiment 2, respectively; the error bars show the standard deviations for these.Table 3. Effect of pont:dmyc interaction on wing and cell size
Genotype | Wing area, mm2 | Cell size, µm2 |
y w / Y; + / + | 1.19 ± 0.03 (6) | 131 ± 6 (6) |
y w / Y; pont - / + | 1.23 ± 0.03 (6) | 139 ± 2 (6) |
y w / Y; rept - / + | 1.22 ± 0.01 (6) | 136 ± 6 (6) |
y w / Y; rept - / + pont - / + | nd | nd |
dmP0 / Y + / + | 1.17 ± 0.01 (7) | 136 ± 6 (7) |
dmP0 / Y; pont - / + | 1.04 ± 0.08 (5) | 124 ± 6 (5) |
dmP0 / Y; rept - / + | 1.15 ± 0.04 (7) | 140 ± 7 (7) |
dmP0 / Y; rept - / + pont - / + | nd | nd |
For details on how wing area and cell size were calculated, see Supporting Materials and Methods. Standard deviations were calculated based on the total number of animals reported (indicated in parentheses). nd, not determined.
Table 4. List of genes that are significantly and in the same direction deregulated by RNA interference against dmyc, pont, and rept
Gene | Function | Affymetrix | dmyc6 | dmyc12 | dmyc48 | pontin | reptin |
Glutactin | basement membrane protein | 141472_at | 1.0 | 1.3 | 1.7 | 2.1 | 1.8 |
Papilin | extracellular matrix metalloprotease | 141837_at | 1.5 | –1.0 | 1.7 | 1.2 | –1.2 |
142182_s_at | 1.4 | 1.2 | 2.1 | 1.9 | 1.8 | ||
midline fasciclin | cell–cell adhesion | 152375_at | 1.6 | 1.3 | 2.5 | 3.6 | 4.1 |
CG3091 | putative role in vitamin E binding | 142199_at | –1.0 | 1.4 | 3.1 | 2.5 | 2.2 |
CG3635 | putative triacyl glycerol lipase activity | 146615_at | –4.4 | 4.4 | 4.6 | 4.2 | 4.9 |
CG4827 | putative 5'-nucleotidase activity | 141307_at |
| –3.7 | 14.0 | 11.2 | 10.1 |
CG14629 |
| 152743_at |
|
| 2.3 | 1.5 | 1.6 |
CG31638 | a myosin | 145904_at | 1.1 | 1.1 | 3.6 | 4.9 | 3.4 |
CG11188 | putative glucose transporter | 145920_at | –1.5 | –8.9 | –8.0 | –7.6 | –7.5 |
CG16807 | putative component of ubiquitin ligase complex | 148891_at | –1.3 | –1.7 | –1.3 | –7.2 | –7.1 |
CG30035 | putative glucose transporter | 147027_at |
| –2.5 | –2.6 | –2.5 | –2.5 |
147028_i_at | 1.2 | 1.1 | –1.9 | –2.2 | –2.6 |
Table 5. Chromatin immunoprecipation results
| Antibodies used (independent immunoprecipitation samples) | % of Input | |||
–613 | –130 | +60 | +187 | ||
Exp. 1 | (Input) | 5.00 | 5.00 | 5.00 | 5.00 |
Control (# 1) | 0.25 | 0.32 | 0.11 | 0.30 | |
Control (# 2) | 0.82 | 0.87 | 0.40 | 0.91 | |
H-dMyc (# 1) | 3.16 | 4.12 | 1.50 | 2.51 | |
H-dMyc (# 2) | 1.81 | 2.43 | 0.74 | 1.67 | |
Pont (# 1) | 2.09 | 2.39 | 0.91 | 2.19 | |
Exp. 2 | (Input) | 5.00 | 5.00 | 5.00 | 5.00 |
Control (# 1) | 0.24 | 0.21 | 0.15 | 0.19 | |
Control (# 2) | 0.20 | 0.22 | 0.13 | 0.15 | |
H-dMyc (# 1) | 1.59 | 2.09 | 1.12 | 1.18 | |
Pont (# 1) | 3.08 | 4.50 | 3.26 | 2.87 | |
Pont (# 2) |
| 3.70 | 3.07 | 2.99 | |
Fragment pos. | Forward primer | Reverse primer |
| ||
-613..-552 | ACTCCTAATAAGGCGGAACCG | CCCGTAACCTCTAACACCCATC | |||
-130..-65 | AGCGTCCCCAAAAGTTCTCTC | CGCGATATCAACGCATGTAGTG | |||
+60..+124 | CAACTTTCGTGAGTGCCACAAG | GTCTCTGGCTCCTTTTACTGCAG | |||
+187..+250 | GAGTGACAGGCGGTATATGTCG | CCACTGTCTTCACGCATTAATTG | |||
For experimental details, see Supporting Materials and Methods. Each number corresponds to the average of two quatitative RT-PCRs using the same immunoprecipitation (as indicated in the column "antibodies used") as template. For the "input" samples, 50 ml of a 1-ml lysate was processed, and the resulting amplification product was defined as 5% of input used for immunoprecipitation. Fragment positions are relative to the transcription start site of mfas.
Supporting Materials and Methods
Determination of Cell Number and Size in Adult Wings.
Single wings were photographed from the same flies as have been analyzed for their eye and ommatidial size. Cell density was assessed by counting the number of trichomes on dorsal and ventral surfaces in a fixed area of 10,000 mm2 just posterior to the posterior cross vein. The area of the whole wing was calculated in pixels with PHOTOSHOP (Adobe Systems, San Jose, CA) and converted to mm2.Immunofluorescence Analysis of Eye Imaginal Discs.
Eye discs from third-instar larvae were dissected and fixed in 4% paraformaldehyde in PBS. Discs were permeabilized by using 1% Triton X-100 in PBS on ice for 10 min, washed in PBS and blocked with 5% BSA in PBS. The primary antibody rabbit anti-phospho-histone H3 (Upstate Biotechnology, Lake Placid, NY) at 1:100 was used together with a 1:30 concentration of rat anti-ELAV (gift of G. Rubin, University of California, Berkeley). Secondary antibodies Texas red anti-rabbit (Jackson ImmunoResearch) and FITC anti- rat (Jackson ImmunoResearch) were used at 1:200 dilution in 5% BSA together with 1 mg/ml DAPI. After washing, discs were mounted in VECTASHIELD (Vector Laboratories) and analyzed in a Leica microscope. Images were processed with OPEN LAB and PHOTOSHOP software.Microarray Analysis.
S2 cells were treated with dsRNA against dmyc, pontin (pont), or reptin (rept) in three biologically independent replicates as described (1). The dmyc and gfp RNA interference samples are identical to the 48-h samples that were described by Hulf et al. (1). After 48 h, the total RNA was harvested from the different samples and processed for analysis on Affymetrix whole-genome microarrays v1.0. The statistical analysis was carried out with CyberT (2). Genes were considered to be differentially expressed if they were called "present" in at least three experimental or three control conditions, differed by >1.5-fold in their expression level from the control, and passed a statistical significance cut-off of P < 0.001.Quantitative Real-Time PCR.
From 60 to 170 eye imaginal discs per genotype were collected from wandering third-instar larvae grown at 25°C under standard conditions. Discs were flash-frozen in liquid N2 and stored at –70°C; total RNA was extracted by using the RNeasy kit (Qiagen, Hilden, Germany) and on-column DNase digestion to eliminate genomic DNA contamination. Reverse transcription was carried out with oligo-dT primers on 0.6 mg of RNA per sample using the Omniscript RT kit (Qiagen). For quantitative real-time PCR we used SYBR green PCR mastermix (Applied Biosystems) on an ABI 7900HT machine and the following primer pairs: actin (reference): 5'- GCCCATCTACGAGGGTTATGC-3' (forward), 5'- AATCGCGACCAGCCAGATC-3' (reverse); tubulin (reference): 5'- GCCAGATGCCGTCTGACAA-3' (forward), 5'- AGTCTCGCTGAAGAAGGTGTTGA-3' (reverse); mfas: 5'- CCTTGGTCAAAACCCATATCGT-3' (forward), 5'- AGCGGACAAATGGCCAGTT- 3' (reverse). All PCR were carried out in duplicates, and control PCR on "no RT" templates (i.e., templates which had been mock reverse-transcribed) confirmed that genomic DNA had been efficiently removed. The following genotypes were used: for experiment 1: y w/Y;+/+, y w/Y;pont–/+, w dmP0 tub>dMyc>Gal4 ey-Flp/Y;+/+, and w dmP0 tub>dMyc>Gal4 ey-Flp/Y;pont–/+; for experiment 2: P{P-Sal}I16/Y; +/+ (this line contains an X-chromosome which is closely matched to the dmP0-bearing chromosome and serves as a wild-type control), P{P-Sal}I16/Y;pont–/+, dmP0/Y;+/+, and dmP0/Y;pont–/+.Chromatin Immunoprecipitations (ChIP).
Untransfected S2 cells or S2 H-dMyc cells (expressing H-dMyc under the hsp70 promoter) were subjected to a 1-h heat shock at 37°C; 3 h later, they were processed for ChIP analysis. Cells were fixed in 2% formaldehyde (in the cell culture medium) at room temperature for 20–30 min, after which glycine was added to 125 mM, and the incubation continued for 5 min. After two washes in TBS (20 mM Tris·HCl, pH 7.4/150 mM NaCl), the cells were harvested in 20 ml of SDS buffer (100 mM NaCl/50 mM Tris·HCl, pH 8.1/5 mM EDTA/0.2% NaN3/0.5% SDS/1 mM PMSF). The pellet obtained after a 6-min centrifugation at 800 ´ g was resuspended in ice-cold IP buffer (a 2:1 mix of SDS buffer and Triton Dilution Buffer: 100 mM Tris·HCl, pH 8.6/100 mM NaCl/5 mM EDTA/0.2% NaN3/5% Triton X-100) at 2 × 107 cells per ml and sonicated to an average chromatin length of 500–1,000 bp (by using six pulses of 30 sec each at setting 3 and 100% duty cycle of a Branson Sonifier 450, separated by 30-sec incubations on ice); 1 ml of sample was then used for each immunoprecipitation. Each immunoprecipitation sample was precleared by mixing with 25 ml of protein G beads [50% slurry (Zymed) in TE (10 mM Tris/1 mM EDTA, pH 8.0) containing 0.2 mg/ml sonicated salmon sperm DNA and 0.5 mg/ml lipid-free BSA] followed by a 30-min centrifugation in an Eppendorf centrifuge at full speed. In parallel, 50 ml of protein G beads (50% slurry as above) were incubated for 3-4 h at room temperature with either 1 mg monoclonal rat anti-HA antibodies, 10 ml polyclonal rabbit anti-Pont antiserum or 60 ml control hybridoma supernatant. Out of 1 ml per immunoprecipitation, 50 ml were set aside to be used as "input control" (5% of input), and the remainder was incubated overnight at 4°C with a specific antiserum coupled to protein G beads. Each immunoprecipitation was carried out in duplicates. The Sepharose beads containing the immunoprecipitate were then subjected to wash steps in 1 ml each of the following buffers: three times with Mixed Micelle Buffer [150 mM NaCl/20 mM Tris·HCl, pH 8.1/5 mM EDTA/5.2% (wt/vol) sucrose/0.02% NaN3/1% Triton X-100/0.2% SDS], twice with Buffer 500 [0.1% (wt/vol) deoxycholic acid/1 mM EDTA/50 mM Hepes, pH 7.5/500 mM NaCl/1% (vol/vol) Triton X-100/0.2% NaN3], twice with LiCl/detergent solution [0.5% (wt/vol) deoxycholic acid/1 mM EDTA/250 mM LiC/l0.5% (vol/vol) Nonidet P-40/10 mM Tris·HCl, pH 8.0/0.2% NaN3], and once in TE. Immunocomplexes were eluted from the beads by a 30 min incubation at 65° in 300 ml 1% SDS/0.1M NaHCO3, followed by an overnight incubation in the same buffer to revert the crosslinks; the "input" sample was diluted with 275 ml of the same buffer and incubated overnight at 65°C. All samples were then diluted in 250 ml of proteinase K solution (0.4 mg/ml proteinase K/0.12 mg/ml glycogen in TE, pH 7.6) and incubated at 37° for 30 min, followed by phenol extraction and ethanol precipitation. Each pellet was then resuspended in 200 ml, of which 10 ml was used as template for duplicate Taqman quatitative RT-PCR reactions on a Perkin–Elmer 5700 machine, using the primers indicated in Table 4. To calculate the amount of DNA fragments retrieved with the different immunoprecipitations, the Ct values of the input samples were used to calculate the threshold amounts of PCR product cfinal (assuming an exponential amplification cfinal = cinitial * 2 Ct and setting cinitial (input) = = 5%), from which then the different cinitial (immunoprecipitation) were derived.1. Hulf, T., Bellosta, P., Furrer, M., Steiger, D., Svensson, D., Barbour, A. & Gallant, P. (2005) Mol. Cell. Biol. 25, 3401–3410.
2. Baldi, P. & Long, A. D. (2001) Bioinformatics 17, 509–519.