Supporting Information

Files in this Data Supplement:

Fig. 6. The Band 4.1B CTD does not alter the cell surface expression level of avb8. (A and B). b8-V5 and the various myc-tagged Band 4.1B constructs were transiently expressed in 293T cells (A) or COS cells (B). Twenty-four hours after transfection, cell surface proteins were biotinylated, and the lysates were immunoprecipitated with anti-b8 (data not shown) or anti-av integrin antibodies, followed by immunoblotting with streptavidin-horseradish peroxidase (HRP). The levels of cell-surface-expressed av and b8-V5 protein are similar in the various transfectants. Note that 293T cells (A) do not express detectable levels of endogenous avb8, whereas COS cells (B) express endogenous avb8 protein. Because of the V5 epitope tag, a molecular weight difference of » 2 kDa is detectable between endogenous b8 and exogenously expressed b8 protein. (C) Characterization of the rabbit anti-Band 4.1B polyclonal antibody. COS cells were mock-transfected or transfected with a myc-tagged full-length Band 4.1B cDNA. Lysates were then immunoblotted with rabbit anti-Band 4.1B. The immunoreactive band at » 140 kDa represents myc-tagged Band 4.1B. The lower immunoreactive band is not observed in the mock-transfected cells and is likely a degradation product of the higher molecular weight Band 4.1B protein. (D) Detergent-soluble lysates from various cell lines were immunoblotted with rabbit anti-Band 4.1B. Note that NIH 3T3 cells and primary neonatal astrocytes, but not Rat1, 293T, or COS cells, express robust levels of endogenous Band 4.1B protein. (E and F) Detergent-solubility analysis for avb8 integrin and Band 4.1B proteins. COS cells transfected with b8-V5 in combination with the various myc-tagged 4.1B constructs were lysed and detergent-soluble (S) and -insoluble (I) fractions were resolved by SDS/PAGE and immunoblotted with anti-myc (E) or anti-V5 (F).

Fig. 7. Immunolocalization of b8 integrin and Band 4.1B proteins in transfected cell lines. (A-I) COS cells were transiently transfected with V5-tagged b8 in combination with myc-tagged full-length Band 4.1B (A-C), myc-tagged CTD (D-F), or myc-tagged FERM domain (G-I). Cells were then plated on LAP, allowed to adhere, and spread for 2 hours, and then immunostained with an anti-V5 mAb (A, D, and G) or an anti-myc polyclonal antibody (B, E, and H). All cells are shown at identical magnification (´ 40). Overexpression of the isolated FERM domain resulted in enhanced cell spreading (G-I). (J-R) 293T cells, which do not express endogenous avb8 protein, were transiently transfected with V5-tagged b8 in combination with myc-tagged full-length Band 4.1B (J-L), myc-tagged CTD (M-O), or myc-tagged FERM domain (P-R). Cells were then plated on LAP, allowed to adhere and spread for 2 hours, and then immunostained with an anti-V5 mAb (J, M, and P) or an anti-myc polyclonal antibody (K, N, and Q). All cells are shown at identical magnification (´ 40). Overexpression of the isolated CTD (M-O) resulted in a punctate expression pattern (N, O), with many cells appearing less spread than those expressing full-length Band 4.1B (J-L). In contrast, and similar to what is observed with COS cells (G-I), overexpression of the isolated FERM domain in 293T cells also resulted in enhanced cell spreading (P-R).

Fig. 8. b8 integrin and Band 4.1B do not colocalize when primary astrocytes are plated on laminin. (A-D) Primary astrocytes cultured from neonatal mice either; av+/- (A, B) or av-/- (C, D) were plated on laminin. Both av+/- (A, B) and av-/- (C, D) astrocytes adhere and spread on laminin. However, Band 4.1B (A, C) and b8 integrin (B, D) do not localize to contact sites, and are diffusely distributed.

Fig. 9. Expression of Band 4.1B proteins does not affect COS cell adhesion to LAP. COS cells were transiently transfected with V5-tagged b8 integrin in combination with myc-tagged lacZ or the various myc-tagged Band 4.1B constructs (indicated on x-axis). Cells were allowed to adhere to LAP for 30 minutes, followed by fixation and staining with crystal violet. Cell adhesion to LAP was quantitated by absorbance at 600 nm.

Fig. 10. avb8 and Band 4.1N display a perivascular pattern of expression in the adult brain. (A-C) avb8 integrin is expressed in a cerebral vessel-associated pattern (A), as determined by colocalization with smooth muscle a-actin (arrows in B and C). (D-F) Band 4.1N also displays a cerebral blood vessel-associated expression pattern (D), as determined by colocalization with smooth muscle a-actin (arrows E and F). (G-I) Band 4.1B is not expressed in a blood vessel-associated pattern (G), and does not colocalize with smooth muscle a-actin (H, I). Note the Band 4.1B expression on white matter axons adjacent to the cerebral blood vessels (arrowheads in G and I).

The following forward and reverse primers were used to generate the various b cytoplasmic sequences: b1F, AAACTTTTAATGATAATT, b1R, TTATTTTCCCTCATACTT, b3F, AAGCTACTCATCACCATT, b3R, AGTCCCCCGGTAGGTGATATT, b5F, AAGCTGCTCGTCACCATCCAG, b5R, CTAGCGTGAGCAAATGGTCCAGG, b6F, AAGCTGCTGGTATCATTT, b6R, CTACCCATCTGAGGAAAGGCCTGC, b8F, AAAGTCCTGATCATTAGACAG, b8R, TTAGAAGTTGCACCTGAAAGCTTC. The N- and C-terminal b8cyto truncations were generated by PCR, using the b8cyto cDNA as a template. The following forward and reverse primer sequences were used to generate the Band 4.1 C-terminal domain (CTD) cDNAs: 4.1GF, CCACCAGTGGTAAAAACA, 4.1GR, TTAATCTTCCC CTTCCTCAGCC, 4.1NF, GAGCCGGAGGCCGTACTGCAG, 4.1NR, TTAGGATTC CTGTGGCTTCTTGT, 4.1RF, CCTCCTCTGGTAAAGACTC, 4.1R-R, TTACT CCTCAGAGATCTCTGTC. The various truncated constructs were inserted into pGBKT7. Expression of the various truncated proteins was verified by Western blotting (data not shown).