Supporting information for Wolfe et al. (2002) Proc. Natl. Acad. Sci. USA, 10.1073/pnas.162346699
Supporting Materials and Methods
Transferrin Receptor (TR) Templates.
The 424A plasmid was constructed by cloning the 2.4-kb BstU I/Xba I fragment containing the TR cDNA from the pCDTR-1 plasmid (1) into the polylinker of the pCDNA3 version 1.1 plasmid (Invitrogen). The 424G plasmid was created by replacing the 525-bp EcoR I/BsaB I fragment from the 424A plasmid with the corresponding fragment containing G at position 424. A mixture containing equal amounts of each plasmid was used as the heterozygous template.PCR Amplification of Genomic DNA.
Primers, 100 mM dNTP stocks, 10 ´ PCRx buffer, 10 ´ PCR enhancer, and 50 mM MgSO4 were all obtained from Life Technologies (Invitrogen). The CYP2C9 assay received a gene-specific preamplification to avoid contamination with the CYP2C19 sequence, which is greater than 90% identical. This reaction contained 1 ´ PCRx buffer, 4 mM MgSO4, 0.2 mM each dNTP, 0.0167 units/ml Platinum Taq polymerase (Invitrogen), 500 m M each (TGTTTTCAGCAATGGAAAGAA and TTCACATGAGCTAACAACCA), and 40 ng of genomic DNA. Cycling protocol was one cycle of (94° C, 120 sec) followed by 45 cycles of (94° C, 15 sec; 53° C, 30 sec; 72° C, 30 sec) followed by one cycle of (72° C, 300 sec). Incorporation and Complete Chemical Cleavage (ICCC) PCR reactions (15 m l) contained 1 ´ PCRx buffer; 1.25 ´ enhancer; 2 mM MgSO4; 5% dimethylsulfoxide (Sigma--Aldrich); 250 m M each dCTP, dGTP, and dTTP (Waters); 125 m M NO2-dATP (Waters); 1 m M each primer (GGAAGAGGAGCATTGAGGAC and GCGGGCTTCCTCTTGAACA for CYP2C9; ACAGGTCAGCCACCACTA and TCTGTCCCGAGTATGCTCTC for CYP2D6); 0.05 units/m l of Pfu (exo- ) polymerase (Stratagene); and either 2.4 ng/m l of genomic DNA (CYP2D6) or 4.5 m l of gene-specific preamplification reaction (CYP2C9). Cycling was performed in an MJ Research PTC 200 thermocycler (Waltham, MA). CYP2C9 received one cycle of (94° C, 240 sec) followed by 10 cycles of (94° C, 15 sec; 50° C, 45 sec; 72° C, 45 sec) followed by 35 cycles of (90° C, 15 sec; 55° C, 20 sec; 72° C, 20 sec). CYP2D6 received one cycle of (94° C, 240 sec) followed by 10 cycles of (94° C, 15 sec; 55° C, 35 sec; 72° C, 35 sec) followed by 35 cycles of (90° C, 15 sec; 57° C, 25 sec; 72° C, 25 sec).Sequence and Mass Information on CYP2C9 and CYP2D6 Genotyping.
Refer to Fig. 6 for a schematic representation of the diagnostic DNA fragments and their origin. ICCC amplification with NO2-dATP using the 2C9 primers listed above produces an amplicon of 41 bp in length. Fragmentation of this amplicon produces the allele-diagnostic fragments, GCGGGCTTCCTCTTGAACACp (Mr = 6,149) for the T allele and GCGGGCTTCCTCTTGAACACGGTCCTCp (Mr = 8,283) for the C allele. Note that the strand being genotyped is opposite the one from which allele designation is derived. The additional fragments, GGAAGAGGAGCATTGAGGACTGTGTTCp (Mr = 8,524) for the T allele and GGAAGAGGAGCATTGAGGACCGTGTTCp (Mr = 8,509) for the C allele, are also produced, and are potentially allele-diagnostic, but their utility is limited by resolving power at high mass.ICCC amplification with NO2-dATP by using the 2D6 primers listed above produces an amplicon 96 bp in length. Fragmentation of this amplicon produces the allele-diagnostic fragments, ACAGGTCAGCCACCACTATGCp (Mr = 6,440) for the T allele and ACAGGTCAGCCACCACTATGCGCp (Mr = 7,058) for the C allele. Note again that the strand being genotyped is opposite the one from which allele designation is derived. The fragment observed at mass 5,331 irrespective of genotype has the sequence pGGGTTCCCCTTGGCCTGp and arises form the middle portion of the amplicon (hence, phosphate groups at both termini). The other primer produces a fragment, TCTGTCCCGAGTATGCTCTCGGCCCTGCTCp (Mr = 9,157), again irrespective of genotype, which is not observed because of its high mass.
1.
McClelland, A., Kuhn, L. C. & Ruddle, F. H. (1984) Cell 39, 267–274.