Identification of 86 candidates for small non-messenger RNAs from the archaeon Archaeoglobusfulgidus -- Data Supplement - Supporting Information -- Proceedings of the National Academy of Sciences

Supporting information for Tang et al. (2002) Proc. Natl. Acad. Sci. USA 99 (11), 7536–7541. (10.1073/pnas.112047299)

Supporting Materials and Methods
Growing and Preparation of Cells from Archaoglobus fulgidus in Culture.
A. fulgidus cells were grown in culture and harvested as described (1). DNA Sequencing and Sequence Analysis.
We sequenced cDNA clones by using the M13 reverse primer RSP and the BigDye terminator cycle sequencing reaction kit (PE Applied Biosystems) on an ABI Prism 377 (Perkin–Elmer) sequencer. We analyzed sequences with the LASERGENE sequence analysis program package. After exclusion of the most abundant known small non-mRNAs (snmRNAs) by filter hybridization screening (see below), »2,000 cDNA sequences were compared to each other by using the lasergene seqman ii program package to identify identical sequences. After a blastn search of the GenBank database (NCBI), all RNA sequences that had not been annotated in GenBank previously were treated as potential candidates for novel snmRNAs. Filter Hybridization and Identification of Clones Encoding Previously Uncharacterized snmRNAs.
For exclusion of the most abundant, known, small RNA species, we end-labeled oligonucleotides (see below) derived from these sequences with [³²P]ATP and T4 polynucleotide kinase and hybridized oligonucleotides to DNA arrays, which were spotted on filters (see above). We performed hybridization in 0.5 M sodium phosphate, pH 7.2/7 % SDS/1 mM EDTA at 53°C for 12 h. Filters were washed (twice, at room temperature, for 15 min in 40 mM sodium phosphate buffer, pH 7.2/0.1 % SDS), exposed to a phosphoimaging screen, and analyzed by computer-aided treatment of hybridization signals (Raytest, Berlin) according to ref. 2. Approximately 10,000 cDNA clones were screened by this selective hybridization procedure, and »2,000 of those exhibiting the lowest hybridization scores were subsequently sequenced. By this method we could significantly increase, from 10 to 19%, the amount of cDNA clones that could not be assigned to already known RNA species and therefore represented potential candidates for novel snmRNAs. Northern Blot Analysis.
Total RNA from A. fulgidus was separated on 8% denaturing polyacrylamide gels [7 M urea/1´ TBE buffer (90 mM Tris/64.6 mM boric acid/2.5 mM EDTA, pH 8.3)] or 1.2% agarose-formaldehyde gels and transferred onto nylon membranes (Quiabrane Nylon Plus, Qiagen, Chatsworth, CA) by using the Bio-Rad semidry blotting apparatus (Trans-blot SD, Bio-Rad). After immobilizing RNAs by using the Stratagene crosslinker, we prehybridized nylon membranes for 1 h in 1 M sodium phosphate buffer, pH 6.2/7 % SDS. Oligonucleotides complementary to potential novel RNA species were end-labeled with [g -³²P]ATP and T4 polynucleotide kinase; hybridization was carried out at 58°C in 1 M sodium phosphate buffer, pH 6.2/7 % SDS for 12 h. We washed blots twice at room temperature in 2´ SSC buffer (20 mM sodium phosphate, pH 7.4/0.3 M NaCl/2 mM EDTA)/0.1 % SDS for 15 min and subsequently at 58°C in 0.1´ SSC/0.5 % SDS for 1 min. Membranes were exposed to Kodak MS-1 film for 3 h to 5 days. Mapping of rRNA Pseudouridines.
Total RNA from A. fulgidus was treated with CMC [N-cyclohexyl-N'-d-(4-methyl-morpholinium)ethylcarbodiimide p-tosylate] and CMC-reactive sites in 16S and 23S rRNAs mapped by primer extension as described (3, 4). Oligonucleotides.
The oligonucleotides used in cDNA synthesis were as follows:

GIBCO1: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(G)₁₅-3'.

The oligonucleotides used for amplification of cloned cDNAs were as follows:

FSP, 5'-CCCAGTCACGACGTTGTAAAACG-3'

RSP, 5'-AGCGGATAACAATTTCACACAGG-3'.

The oligonucleotides used for selective hybridization were as follows:

Af-5S, 5'-GGCTTAACTTCCGGGTTCGGAATG-3'

Af-5S-1, 5'-ACGGTTCCCGCAGTTCCCGT-3'

Af-16S1A, 5'-CCGTCCGCCGGTGCTTGCATCC-3'

Af-16S1B, 5'-CGGAGATGGGACATTCCAGTAC-3'

Af-16S.2, 5'-GCCGTTGCCCGCACCTTC-3'

Af-16S.3, 5'-TGGCTTGACGGGCGGTGTGTG-3'

Af-23S.1, 5'-GCTCGTACTCGCGCCTCTCAGCACT-3'

Af-23S.2, 5'-CGGCGCGGGCGATTAGTGA-3'

Af-23S.3, 5'-CAACTTGCCGAATTCCCTCGGC-3'

Af-23S.4, 5'-AGGCCAGGGTGGTTCGCTAGGC-3'

SNI, 5'-ACTAGTTCTAGATCGCGAGCGCCGCTC-3'.

The oligonucleotides used for the mapping of rRNA pseudouridines were as follows:

Psi-16S.1, 5' -TGACTTAACAGGATGCTTCACA-3' (for Y 1004)

Psi-16S.2, 5'-ATTGTAGCCCGCGTGTAGCCCG-3' (for Y 1167)

Psi-23S.1, 5'-ATTCTCACCCGACTATGCTGCT-3' (for Y 1364)

Psi-23S.2, 5'-ACACCCCCGTTAGATAGCAACC-3' (for Y 2601 and Y 2639)

Psi-23S.3, 5'-ACCGCGGGCTGAACGGCTCGCC-3' (for Y 2878).

Supporting Results and Discussion
Expression Analysis of Previously Uncharacterized snmRNAs.
After computational analysis of cDNA clones (Fig. 3), we performed expression analysis of previously uncharacterized snmRNA candidates by Northern blotting to determine their size and abundance; the expression of selected examples for previously uncharacterized snmRNAs in A. fulgidus is shown in Fig. 4. H/ACA-Box Small Nucleolar RNAs.
Prominent among the four A. fulgidus candidates is Afu-4, with its highly stable secondary structure organized in three long stems, each containing a typical pseudouridylation pocket, immediately followed by a downstream, single-stranded H- or ACA-box motif (Fig. 5). Intriguing is the abundance of clone Afu-4, which represents (with a total of 77 independent cDNA clones isolated) the second most abundant cDNA in our library next to clone Afu-7. Strong expression of Afu-4 snmRNA (230 nt) was confirmed by Northern hybridization (see Fig. 4). Afu-46, Afu-52, and Afu-190 also appear as likely rRNA pseudouridylation guides consisting of a single, long stable stem positioned immediately upstream from an ACA motif (Fig. 5). Expressed Sequence Tags for Hypothetical Proteins from the A. fulgidus Genome.
In addition to the 86 candidates for snmRNAs described, we have identified a total of 182 cDNA clones derived from ORFs encoding hypothetical or known proteins (76 and 106 cDNA clones, respectively). The 182 sequences should be treated as useful information, because they represent expressed sequence tags (so-called ESTs) of potential protein genes transcribed from the genome of A. fulgidus (Table 3).

1. Stetter, K. O., Lauerer, G., Thomm, M. & Neuner, A. (1987) Science 236, 822–824.

2. Maier, E., Meier-Ewert, S., Ahmadi, A. R., Curtis, J. & Lehrach, H. (1994) J. Biotechnol. 35, 191–203.

3. Bakin, A. & Ofengand, J. (1993) Biochemistry 32, 9754–9762.

4. Stern, S., Moazed, D. & Noller, H. F. (1988) Methods Enzymol. 164, 481–489.