Bilioni et al. 10.1073/pnas.0502480102. |
Fig. 8. EMSA with Mirr and the consensus motif (AAAAACACGTGTTAA). For this figure and other figures, an arrow indicates the Iro--DNA complex and arrowhead indicates the Ab supershifted complex. Asterisks indicates a nonspecific band.
Fig. 9. Mirror does not bind a TAAT site. (A) Mirr does not bind the classic HOX (TAAT) motfs found in the goosecoid DE and paired P3 enhancer elements. (B) EMSAs with FLAG-Mirr showing that a point mutation within the L3 enhances that changes the ACA half site to AtA can abolish binding. (C) The Mirr--homeodomain (HD) construct does not bind the mutated L3 enhancer element (ACA to AtA). Asterisks indicate nonspecific bands.
Table 1. Summary of EMSA binding for oligonucleotides tested
Sequences tested | Binding |
caggtttggagAAAAACACGTGTTAAgc | ++++ |
(MEME consensus) | |
ggtggctaACA CG TGTtctgtgtgg | +++ |
(ACAnnTGT motif, GC spacer) | |
ggtggctaACA TA TGTtctgtgtgg | +++ |
(ACAnnTGT motif, TA spacer) | |
ggttctttgatcacttgACAtgTGTttgtgtgtgc | +++ |
(ACAnnTGT , different flanking sequence) | |
ggtggctaAtA CG TaTtctgtgtgg | -/+ |
( point mutated motif ) | |
ggtggctaACA cg ACActgtgtgg | - |
( direct repeat 2N spacer) | |
ggtggctaACA cga ACActgtgtgg | - |
(direct repeat 3N spacer) | |
cgtttACATGTttttctccaaacctg | (+) |
( no spacer) | |
cgtttACAcTGTttttctcca | + |
(1N spacer) | |
cgtttACA cgc TGTttttctcca | +(+) |
(3N spacer) | |
cgtttACA tata TGTttttctcccaaacctg | + |
(4N spacer) | |
cgtttACA tatata TGTttttctcccaaacctg | (+) |
(6N spacer) | |
ggtggctaACAtactgcatgaaTGTtctgtgtgg | - |
(11N spacer) | |
gctaagttaattaacacagaaatcaaattgc | + |
(L3 enhancer) | |
gctaagttaattaaTacagaaatcaaattgc | - |
(L3 enhancer point mut ) | |
ctagccattaatcagattaacggtgagcaattaga | - |
(DE goosecoid) | |
taaataataaaaaACAttTGTttgataattgttctgt | +++ |
(krüppel 3’ genomic ) | |
ggatagaaaatACAaaTGTaatgtaattgcacacataccgattagttagaatttgtttacatgtttggacaggaac | +++ |
cggcacttaactcgttatcgaccaaaacaaaaactagttagacgaaaatagagagctgcgaaaacactaagagttct | |
ctccgtacgaaactttctctcACAcaTGTatcatatgt | |
(krüppel intron) |
Supporting Materials and Methods
DNA Constructs and Protein Expression.
Full-length mirr was amplified with PCR primers introducing NcoI and BglII sites and cloned into the pFTX9 vector (FLAG-tag) or the pFTX11 (HA tag) (1). mirr HD was amplified with NcoI-Cla primers and subcloned into the same vector. Drosophila Ara and mouse Irx4 cDNAs were cloned into Nco-Xho sites of pFTX9 after addition of an Nco site at the initial ATG. Proteins were produced in vitro using a coupled transcription/translation rabbit reticulocyte lysate system (Promega).Binding-Site Selection and Mobility Shift Assays.
Selection of DNA sequences was carried out according to Pollock and Treisman (2) by using the degenerate oligonucleotide R76. The R76 oligo was labeled with [32P]dCTP and [32P]dATP by PCR using primers F and R. Mirror and FLAG-Mirror proteins were synthesized in vitro by using the coupled transcription/translation rabbit reticulocyte lysate system (Promega). Binding reactions were in 25 mM Hepes (pH 7.5), 0.2 mM EDTA, 0.2 mM EGTA, 100 mM KCl, 0.1% Nonidet P-40, 1 mM DTT, 600 ng poly(dIdC)-(dIdC), 3 mM MgCl2, and 20% glycerol. Two microliters of reticulocyte lysate was mixed with 0.2 ng of labeled probe (for the first round 0.4 ng of probe was used) in the presence of protease inhibitors (Roche).Protein–DNA complexes were allowed to form at room temperature for 20 min and were immunoprecipitated with either an affinity-purified rabbit-Mirr peptide antibody (3) bound to protein-A Sepharose beads (Amersham) or –FLAG-coated agarose beads (Sigma). DNA was recovered from the beads, amplified by PCR using primers F and R, and used for a total of four rounds of selection. Selected oligos were subjected to EMSA. Bands appearing after four rounds of selection were excised, and DNA was recovered, amplified, and cloned using the TOPO-TA cloning system (Invitrogen). Inserts were sequenced, and the sequences corresponding to the random core of the R76 oligo were analyzed by using the MEME motif elicitation tool. Consensus sequences were tested in mobility shift assays with in vitro-translated FLAG-Mirror, and specific binding was verified by –FLAG and –Mirror supershifts. All subsequent mobility shift assays were performed in the same conditions as the site selection using 30,000 cpm of labeled probe per reaction (adapted from ref. 4).
Oligonucleotides for Site Selection and Reporter Analysis.
R76:
CAGGTCAGTTCAGCGGATCCTGTCG(N26)GAGGCGAATTCAGTGCAACTGCAGC;PAL:
GCCGCAATTAACACGTGTTAATTGGTGGCTAATTAACACGTGTTAATTGGTGGCTAATTAACACGTGTTAATTGGTGGCTAATTAACACGTGTTAATTGGTGGCTGGTAC;MUT
:GGCCGCAATTAATACGTATTAATTGGTGGCTAATTAATACGTATTAATTGGTGGCTAATTA ATACGTATTAATTGGTGGCTAATTAATACGTATTAATTGGTGGCTGGTAC.Fly Strains.
Fly strains were as follows: yw (y,w), hs-Mirr (w; PKB-mirror), ry (cn;ry), Fng-Gal4 (w; P{w+mW.hs = GawB} fng/TM3), UAS-Mirr (w1118; pUAST12), mirr-lacZ (F7).In Vivo
Reporter Assays. Oligonucleotides with four repeats of the consensus (PAL) and the mutated motif (MUT) were cloned the pGbe-lacZ vector (5), which carries three copies of the binding element for the Grainyhead transcriptional activator cloned upstream of the LacZ reporter. Constructs were coinjected in cn,ry embryos to generate Pry+ transformants.Luciferase Reporter Assays.
A 502-bp of the Fng 3' region, flanking the Iro binding site (IBS), was PCR amplified from Drosophila genomic DNA and inserted into the pGL3-Promoter vector (Promega). An equivalent construct was also made in which the fng IBS was mutated (ACAATTGT to ATAAGTAT) using the QuikChange site-directed mutagenesis kit (Stratagene). For RNAi, S2 cells were propagated and treated with dsRNA as described in ref. 6. In brief, dsRNA synthesis was performed using primer sequences, flanked with T7 sites, designed to amplify »500 bp of exonic sequence of Mirror and GFP. dsRNA was generated by using the MegaScript kit (Ambion, Austin, TX). Cells were grown for 4 days before transfection with the reporter constructs, along with the pEF-LacZ control plasmid, using Effectene Transfection Reagent (Qiagen, Valencia, CA). Each transfection was performed in triplicate. The cells were left for an additional 2 days before harvesting in reporter lysis buffer (Promega) and assayed using luciferase assay system (Promega). b-gal assays were performed as an internal control for transfection, using chlorophenol red-b-D-galactopyranoside (Calbiochem) as a susbstrate and quantitated spectrophotometrically. Samples also were loaded on SDS/PAGE gels, and the depletion of Mirror protein was monitored using rat anti-Mirror antibody (3).Staining of Eye-Antennal Disks.
Third-instar larval eye imaginal discs were fixed in 2% glutaraldehyde for 10 min at 22°C and incubated with X-Gal at 37°C as described in ref. 7.1. Howell, M., Itoh, F., Pierreux, C. E., Valgeirsdottir, S., Itoh, S., ten Dijke, P. & Hill, C. S. (1999) Dev. Biol. 214, 354–369.
2. Pollock, R. & Treisman, R. (1990) Nucleic Acids Res. 18, 6197–6204.
3. Yang, C., Simon, M. & McNeill, H. (1999) Development (Cambridge, U.K.) 126, 5857–5866.
4. Germain, S., Howell, M., Esslemont, G. M. & Hill, C. S. (2000) Genes Dev. 14, 435–451.
5. Jennings, B, Tyler, D. & Bray, S. (1999) Mol. Cell. Biol. 19, 4600–4610.
6. Clemens, J.C., Worby, C.A., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B.A., and Dixon, J.E. (2000) Proc. Natl. Acad. Sci. USA 97, 6499–6503.
7. McNeill, H., Yang, C., Ungos, J. & Simon, M. (1997) Genes Dev. 11, 1073–1082.