Draper et al. 10.1073/pnas.0506081102.

Supporting Information

Files in this Data Supplement:

Plasmid Construction
Supporting Table 6




Table 6.

 Oligonucleotides used for PCR amplifications

Name

Sequence (5'-3')

NotI-Ptac

CCAGCGGCCGCTTATCGACTGCACGG

NotI-oriT1

CCAGCGGCCGCTCATTTTCTGCATCAT TGT

KmXba3

ccatctagatcagaagaactcgtcaag

KmBamH5

ccaggatcctcatgttgacagcttatc

LacIqXba3

ccttctagattaattgcgttgcgctca

LacIqXba5

cgctctagactgatcggtcgaaattcc

Xba-Pmob

ccatctagactacaatattgccgcaac

TrwAstop-NdeI

tcacatatgtcaatcctccttcccctc

Eco-oriT335

AACGAATTCATGTCCTCTCCC

Kpn-oriT1

AACGGTACCTCATTTTCTGCATCATTG

KpnHindSDnptIIF

GACGGTACCAAGCTTCAGGATGAGGATCGTTTC

BamHindnptIIR

GCAGGATCCGCTAAGCTTTGTCGGTCATTTCGA

oriP1

CACGAATTCCGGCCAGCCTCGCAG

M13 (-40)

GTTTTCCCAGTCACGAC

M13R (-48)

AGCGGATAACAATTTCACACAGGA

Introduced restriction sites are underlined.





Plasmid Construction. Plasmids were constructed by using standard recombinant DNA methodology. Fragments were obtained by restriction digests and gel extraction or amplified by PCR with Vent polymerase (New England Biolabs) with oligonucleotides incorporating the appropriate restriction sites for cloning in the respective vectors. Restriction enzymes and T4 DNA ligase were from Fermentas (Hanover, MD). PCR products were confirmed by DNA sequencing. Oligonucleotides used for PCR amplification (obtained from Sigma) are listed in Table 6.

Plasmids constructed to test TrwC transfer.

pET29::trwABC and pET29::trwAC contain R388 trwABC or trwAC, respectively, with their own promoter cloned into kanamycin-resistant (KmR) Novagen vector pET29c. Both were constructed in two steps:

pET29::trwABC: first, the SspI-HindIII fragment from pSU4052 including R388 MOBw region (PABC-trwABC) was cloned into the HincII-HindIII sites of pUC9, rendering pMTX317. Second, the PABC-trwABC BamHI-HindIII fragment from pMTX317 was cloned into the same sites of vector pET29c.

pET29::trwAC: first, a BamHI-BglII PABC -trwAC fragment from pET3::trwAC (described below) was cloned into the BamHI site of pUC9, rendering pCIG1002. Second, the PABC -trwAC XbaI-BamHI fragment from pCIG1002 was cloned into the same sites of vector pET29c.

pKM101Dmob is a deletion derivative of plasmid pKM101 by SmaI digestion and religation. The resulting plasmid still codes for the T4SS but has lost the oriT-traKJI fragment of the transfer machinery.

pBBR::oriT was used because of the need of an oriT-containing plasmid in a vector compatible (in replicon and antibiotic resistance) with plasmids pET29::trwABC, pKM101Dmob and pSU4028. pBBR::oriT contains R388 oriT amplified with oligonucleotides NotI-Ptac and NotI-oriT1 (Table 6) cloned into the NotI site of GmR vector (Gm, gentamicin) pBBR6 .

Substrate plasmids to monitor

 oriT-oriT recombination. Substrate plasmids carry two R388 oriT direct repeats flanking a kanamycin-resistance determinant (npt II) and repressor lacIq (Fig. 2a). This cassette in vectors pGEM-3Z (Promega) or pSU19 gives rise to pRec2oriT-Ap and pRec2oriT-Cm, respectively. The cassette was derived from the substrate plasmid pSU1470 to make it simpler and more amenable to subsequent modifications.

pRec2oriT-Ap was constructed in several steps. First, the npt II gene was amplified with oligonucleotides KmXba3 and KmBam5 (Table 6) from plasmid pSU1470, digested with BamHI and XbaI, and cloned into the pSU1470 backbone obtained by digestion with the same enzymes; this construction was named pCIG1015. Second, the lacIq gene was amplified with oligonucleotides LacIqXba3 and LacIqXba5 (Table 6) from pSU1470; the product was digested with XbaI and cloned into the same site of pCIG1015. A clone was selected with the lacIq insert transcribed in the opposite direction with respect to the lactose promoter. The XbaI site between the lacIq gene and the npt II gene is methylated.

pRec2oriT-Cm was also constructed in two steps. First, plasmid pMTX315 was constructed by cloning the recombination cassette from pSU1470 into CmR vector pSU19. The »6-kb cassette was obtained by partial EcoRI-HindIII digestion of pSU1470 and cloned into the same sites of pSU19. In a second step, the BamHI-XbaI cassette from pRec2oriT-Ap was cloned in the same sites of pMTX315. Thus, pRec2oriT-Cm contains exactly the same recombination cassette as pRec2oriT-Ap.

Helper plasmids for

 oriT-oriT recombination. To create pET3::trwAC, trwA and its own promoter (PABC) were amplified with oligonucleotides Xba-Pmob and TrwAstop-NdeI (Table 6) and placed 5' of the trwC gene in XbaI-NdeI sites of plasmid pSU1621 .

To construct pET3::trwACmut, the TrwC mutant fragment (yielding Y18FY26F) was transferred from plasmid pSU4758 to plasmid pSU1621; then, the NdeI-SacI fragment containing the mutation was cloned into the same sites of pET3::trwAC.

pClomob::oriT was constructed as a negative control to test oriT-oriT recombination in recipient cells by inserting a HindIII-XbaI R388 oriT fragment from pSU1192 into the same sites of pSU4814, a plasmid that carries the mob region of plasmid CloDF13 in vector pSU19.

Plasmids to check for TrwC-mediated integration.

Plasmid pR6K::oriTW contains R388 oriT followed by a silent npt II gene, in a CmR vector with the R6K origin of replication, so it can be maintained only in pir strains. This plasmid was constructed as follows. pOD3 is a derivative of pSU1371 in which two PCR fragments were inserted (see oligonucleotides in Table 6): (i) an EcoRI-KpnI fragment containing bp 1-330 of R388 oriT, and (ii) a 837-bp KpnI-BamHI fragment containing a npt II gene from Tn5tac1, including the ribosomal binding site but without promoter. The EcoRI-BamHI fragment from pOD3 was cloned into vector pSW23, which contains the R6K origin of replication.

Plasmid pR6K::oriTW oriTP was obtained by insertion of a 300-bp EcoRI fragment containing RP4 oriT into the EcoRI site of pR6K::oriTW. The orientation was selected so that the nic site lies in the same DNA strand as that of R388, and R388 oriT is the first DNA transferred after the RP4 oriT. The RP4 oriT fragment was obtained from plasmid pMTX326, a pUC9 derivative containing the PstI fragment from plasmid RP4 that includes oriT and traJ (oriT close to the EcoRI site of pUC9). The oriT fragment flanked by EcoRI restriction sites was obtained by PCR amplification with oligonucleotides oriP1 and M13 (-40) (Table 6).

The target plasmid for integration assays was pKK::oriT. To construct this plasmid, a 450-bp EcoRI-HindIII fragment from plasmid pSU1186 including R388 oriT was cloned into the same sites of vector pKK223-3, downstream the vector Ptac promoter.

Plasmid pKK::oriT-Km was constructed to confirm that the expected integration events in pKK::oriT would render kanamycin-resistant bacteria. The 826-bp HindIII fragment containing the npt II gene without promoter from plasmid pR6K::oriTW was cloned into the HindIII site of pKK::oriT, and the orientation that leaves the npt II ORF downstream the vector Ptac promoter was selected. This plasmid was in fact resistant to kanamycin.

1. Bolland, S., Llosa, M., Avila, P. & de la Cruz, F. (1990) J. Bacteriol. 172, 5795-5802.

2. Winans, S. C. & Walker, G. C. (1985) J. Bacteriol. 161, 402-410.

3. Elzer, P. H., Kovach, M. E., Phillips, R. W., Robertson, G. T., Peterson, K. M. & Roop, R. M., 2nd (1995) Plasmid 33, 51-57.

4. Bartolomé, B., Jubete, Y., Martínez, E. & de la Cruz, F. (1991) Gene 102, 75-78.

5. Llosa, M., Bolland, S., Grandoso, G. & de la Cruz, F. (1994) J. Bacteriol. 176, 3210-3217.

6. Guasch, A., Lucas, M., Moncalián, G., Cabezas, M., Pérez-Luque, R., Gomis-Rüth, F. X., De La Cruz, F. & Coll, M. (2003) Nat. Struct. Biol. 10, 1002-1010.

7. Grandoso, G., Avila, P., Cayón, A., Hernando, M. A., Llosa, M. & de la Cruz, F. (2000) J. Mol. Biol. 295, 1163-1172.

8. Llosa, M., Bolland, S. & de la Cruz, F. (1991) Mol. Gen. Genet. 226, 473-483.

9. Núñez, B. & de la Cruz, F. (2001) Mol. Microbiol. 39, 1088-1099.

10. Chow, W. Y. & Berg, D. E. (1988) Proc. Natl. Acad. Sci. USA 85, 6468-6472.

11. Demarre, G., Guerout, A. M., Matsumoto-Mashimo, C., Rowe-Magnus, D. A., Marliere, P. & Mazel, D. (2005) Res. Microbiol. 156, 245-255.