Supporting information for Zhou et al. (2002) Proc. Natl. Acad. Sci. USA, 10.1073/pnas.212392399
Fig. 3.
(a) Schematic of replication pattern of Igh genes in MEL and in pro- and pre-B cells, as described in the text and previously in (13). The replication pattern of Igh genes in plasma cell lines and in some B cell lines resembles the triphasic pattern of MEL although the specific DNA sequences are different as a result of VDJ joining and class switching (3). The 3' regulatory region (3' RR) is indicated, and the region encompassed in 199M11 is shown. (b) In vitro translation of cDNA for mouse Mta1 confirms a predicted open reading frame. Total RNA was isolated from the MEL and A20 cell lines using Trizol (GIBCO/BRL), following the company's protocol. SuperScript II RNaseH Reverse Transcriptase, also from GIBCO/BRL, was used for RT-PCR to generate cDNA. The Advantage cDNA PCR kit was used to amplify specifically the Mta1 cDNA by using nested primers derived from 5' and 3' sequences of rat Mta1 that were homologous to human MTA1. Outside primers: 5' sequence is GGCCCCGCCGCCGGCCCGGAC, 3' sequence is TCACTGGATACTCTGGGGCTGATGG; inside primers: 5' sequence is ATGGCCGCCAACATGTACAGGGTCGGAGAC; 3' sequence is CTAGTCCTCAATAACAATGGGCTCATCATTG. The 5' primers are adjacent, with the inside primer beginning at the start codon. The 3' inside primer ends at the stop codon with the 3' outside primer located 30 bases further downstream. PCR products were gel extracted and cloned into the PCRII vector (Invitrogen). In vitro transcription and translation was carried out using the TNT-coupled reticulocyte lysate system kit from Promega with the addition of [35S]methionine. Proteins were analyzed by SDS/10% PAGE, followed by autoradiography. (c) Northern analysis of Crip and Mta1 expression in MEL. Northern analysis was carried out using standard conditions.1. Michaelson, J. S., Ermakova, O., Birshtein, B. K., Ashouian, N., Chevillard, C., Riblet, R. & Schildkraut, C. L. (1997) Mol. Cell. Biol. 17, 61676174.
2. Ermakova, O. V., Nguyen, L. H., Little, R. D., Chevillard, C., Riblet, R., Ashouian, N. Birshtein, B. K. & Schildkraut, C. L. (1999) Mol. Cell. 3, 321330.
3. Zhou, J., Ermakova, O. V., Riblet, R., Birshtein, B. K. & Schildkraut, C. L. (2002) Mol. Cell. Biol. 22, 48764889.