Zhang et al. 10.1073/pnas.0506982103. |
Fig. 7. GW4064 treatment lowers plasma glucose levels in an FXR-dependent manner. Wild-type (WT) and FXR-/- mice were treated twice daily with either vehicle (open bars) or the FXR agonist GW4064 (filled bars) for 4 days (n = 6 per group). Plasma glucose levels were determined after a 6-h fast. *, P < 0.05.
Fig. 8. Hepatic expression of FXRa2-VP16 lowers free fatty acids and b-hydroxybutyrate in db/db mice. Nine-week-old female db/db mice were transfused with adenovirus expressing VP16 alone or FXRa2-VP16 by tail vein injection (n = 6 per group). On day 13, after a 6-h fast, plasma free fatty acids (FFA) (A) and b-hydroxybutyrate (B) were quantified and hepatic mRNA levels was determined by using real-time PCR (C). IR, insulin receptor. Glut2, glucose transporter 2. Glut4, glucose transporter 4. IDE, insulin degrading enzyme. *, P < 0.05.
Fig. 9. Plasma insulin levels during a glucose tolerance test in db/db mice. Nine-week-old female db/db mice were transfused with adenovirus expressing VP16 alone or FXRa2-VP16 by tail vein injection (n = 6 per group). After 7 days, the mice were fasted for 16 h before i.p. injection of 1.8 g/kg glucose. Plasma insulin levels were measured at the indicated time points. *, P < 0.05 versus "0" time point. A significant change in plasma insulin levels was observed only in db/db mice transfused with Ad-FXRa2-VP16 mice.
Fig. 10. GW4064 treatment of KK-A(y) mice lowers plasma glucose levels and reduces hepatic G6Pase mRNA levels. (A) KK-A(y) mice were treated with GW4064 for 4 days (n = 5 per group). Plasma glucose levels were measured after a 6-h fast. (B) Hepatic mRNA levels. The indicated hepatic mRNA levels were determined in the same mice after a 6-h fast by real-time PCR. *, P < 0.05, **, P < 0.01.
Fig. 11. Identification of PEPCK as a direct FXR target gene. (A) An FXR response element (FXRE) sequence is shown in the PEPCK proximal promoter. The mutant sequence is also shown (GG to CC). (B) Gel mobility shift binding assays were performed by using 32P-labeled wild-type oligo DNA and the competition assay was performed by using excess cold wild-type or mutant oligo DNA (10×, 50×, and 500×). (C) HepG2 cells were transiently transfected with the expression plasmid CMX-FXRa2 (FXR) or the empty plasmid (no FXR), and pGL3-PEPCK WT (WT) or pGL3-PEPCK MUT (MUT) and then treated with GW4064 (1mM), where indicated. After 36 h, cells were harvested and luciferase activity was measured and normalized to b-galactosidase activity. The data represent the means ± SE of three independent experiments, each performed in triplicate. #, P < 0.001. Computer-assisted analysis of the extended FXRE sequence in the PEPCK promoter failed to identify high-affinity binding sites for other transcription factors.
Fig. 12. GW4064 treatment lowers plasma glucose levels in ad libitum-fed db/db mice. Nine-week-old male db/db mice were treated with vehicle or GW4064 (30 mg/kg, twice a day) for 5 days. The mice had free access to standard chow diet until being killed. Plasma glucose levels were measured (A) and hepatic mRNA levels were quantified by real-time PCR (B) (n = 6 per group). *, P < 0.05. **, P < 0.01 versus control.
Fig. 13. Effect of FXR deficiency on basal glucose production/utilization. Wild-type or FXR–/– mice (KO) were injected with either saline or 10% pyruvate solution (2 g/kg body weight) (n = 7-9 per group) after a 16-h fast. After 2 h, plasma glucose levels were measured. *, P < 0.05 versus saline-injected control. NS, nonsignificant.
Supporting Methods
Real-Time PCR.
Sequences of primers/probes used are as follows: phosphoenolpyruvate carboxykinase (PEPCK) forward primer, GGCCACAGCTGCTGCAG, reverse primer, GGTCGCATGGCAAAGGG, probe, CACAAGGGCAAGATCATCATGCACGA; glucose-6-phosphatase (G6Pase) forward primer, CTGTGAGACCGGACCAGGA, reverse primer, GACCATAACATAGTATACACCTGCTGC, probe, CCCTCTGGCCATGCCATGGG. Scavenger receptor class B, type 1 (SR-BI) and SREBP-1c were detected by using SYBR Green. The sequences are SR-BI forward primer, CCTTCAATGACAACGACACCG, reverse primer, CCATGCGACTTGTCAGGCT; SREBP-1c forward primer, GGAGCCATGGATTGCACATT, SREBP-1c reverse primer, GCTTCCAGAGAGGAGGCCAG. The sequences for SHP, cyclophilin, and farnesoid X receptor (FXR) have been described in ref. 1. Results were normalized to cyclophilin or 36B4.Determination of d-Glucose Incorporation into Glycogen
. Monolayers of murine primary hepatocytes were washed three times with 1xPBS and incubated in serum-free DMEM containing 2 mCi/ml 14C-D-glucose (Amersham Pharmacia) for 2 h (2). The medium was then removed, and the cells were washed three times by using ice-cold 1× PBS before addition of 1 N NaOH (500 ml per well). The plates were incubated for 1 h at 50°C. A 250-ml aliquot (the remainder was used for determination of protein concentration) was transferred to a new Eppendorf tube, and 10 ml of 50 mg/ml unlabelled glycogen was added as a carrier. The glycogen was precipitated with 750 ml of 95% ethanol at –20°C for 30 min. After centrifuge at 15,000 × g for 15 min at 4°C, the glycogen pellets were washed 3 times with 75% ethanol and then redissolved in 250 ml of 1M NaOH by heating at 60°C for 30 min. A 200-ml aliquot was used for liquid scintillation counting. The incorporation of d-glucose to glycogen was normalized to cellular protein levels.Western Blot.
Liver samples were homogenized in a solution containing 50 mM Hepes (pH 7.5), 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM sodium pyrophosphate, 10 mM sodium fluoride, 2 mM EDTA, 1% Nonidet P-40, 1 mM PMSF and complete protease inhibitor mixture (Roche Diagnostics) and then incubated at 4°C for 1 h. After centrifugation at 15,000 × g for 30 min, the supernatant was removed and protein concentration was determined. Proteins were separated on 10% SDS/PAGE and transferred to a nitrocellulose membrane. To detect phosphorylated IRS-1 or IRS-2, 3 mg of soluble hepatic proteins were incubated overnight with 3 mg of IRS-1 or IRS-2 antibody (Upstate Biotechnology, Lake Placid, NY), followed by incubation with protein A-Sepharose for 2 h. After extensive washing, proteins were separated on 6% SDS/PAGE and detected by using either anti-phosphotyrosine 4G10 (Upstate Biotechnology) or anti-IRS-1 or IRS-2 antibody. Antibodies against phospho-GSK3b (Ser-9), GSK3b, phospho-Akt, or Akt (Ser-473) were from Cell Signaling Technology (Beverly, MA).Transient transfection.
The mouse PEPCK promoter (–1000 to +40 bp) was cloned into pGL3 vector (SacI/XhoI sites) to construct pGL3-PEPCK WT. The mutant promoter (pGL3-PEPCK MUT) was constructed by mutation of the FXRE by using a mutagenesis kit (Stratagene). Transient transfections were performed in HepG2 cells as described in ref. 1.Gel Mobility Shift Assay.
Gel mobility shift assay was performed as described in ref. 1.1. Zhang, Y., Kast-Woelbern, H. R. & Edwards, P. A. (2003) J. Biol. Chem. 278, 104–110.
2. Perdomo, G., Commerford, S. R., Richard, A. M., Adams, S. H., Corkey, B. E., O’Doherty, R. M. & Brown, N. F. (2004) J. Biol. Chem. 279, 27177–27186.