Expression of Th1-mediated immunity in mouse lungs induces a Mycobacterium tuberculosis transcription pattern characteristic of nonreplicating persistence -- Data Supplement - Supporting Information -- Proceedings of the National Academy of Sciences

Supporting information for Shi et al. (2002) Proc. Natl. Acad. Sci. USA, 10.1073/pnas.0136863100

Table 1. Sequences of PCR primers and probes for host gene expression measurements

Gene	Primers	Probe
IFN-g	cattgaaagcctagaaagtctgaataac	FAM tcaccatcctttgccagttcctccagBHQ1
	tggctctgcaggattttcatg
NOS-2	cagctgggctgtacaaacctt	FAM cgggcagcctgtgagacctttgaBHQ1
	cattggaagtgaagcgtttcg

All oligonucleotide sequences are shown in the 5' to 3' direction. Probes were 6-carboxy-fluorescein (FAM)-labeled at the 5' end and Black Hole Quencher 1 (BHQ1)-labeled at the 3' end.