Sugimoto et al. 10.1073/pnas.0601015103.

Supporting Figures

Files in this Data Supplement:

Supporting Figure 5
Supporting Figure 6
Supporting Figure 7
Supporting Figure 8
Supporting Figure 9
Supporting Figure 10
Supporting Figure 11
Supporting Figure 12
Supporting Figure 13
Supporting Figure 14





Supporting Figure 5

Fig. 5. Distribution of SCS in families in the QTL study.





Supporting Figure 6

Fig. 6. The maximum LOD score on each chromosome obtained by the first screening.





Supporting Figure 7

Fig. 7. Alignment of predicted amino acid sequences of cattle (12G, AY644769; 13G, AY644770), human (NP_060478), and mouse (NP_536681) FEZL. A yellow box indicates a glycine stretch, and blue arrows indicate six C2H2 type zinc-finger domains.





Supporting Figure 8

Fig. 8. Transfected V5-tagged FEZL stained by fluorescein isothiocyanate (green) is localized in the nucleus stained by 4', 6-diamidino-2-phenylindole (blue). The scale bar indicates 8 mm.





Supporting Figure 9

Fig. 9. Consensus binding sequence. Checked boxes indicate sequences bound with 13G FEZL and others bound with 12G FEZL.





Supporting Figure 10

Fig. 10. Gel mobility shift assay with a consensus site (AGCAGAAGCAGAAGCAGA) and AP2 (GATCGAACTGACCGCCCGCGGCCCGT).





Supporting Figure 11

Fig. 11. FEZL binding sequences whose BLAT scores exceed 100. Black bars indicate exons, and a green bar includes the start codon in diagram of SEMA5A gene.





Supporting Figure 12

Fig. 12. FEZL, SEMA5A, TNF-a, and IL-8 expressions in OCUB-M cells transfected with siRNAs. Results are means ± SEM (n = 9; three experiments) of quantity relative to OCUB-M cells transfected without constructs. Symbols denote statistically significant results as determined by Student’s t test (**, P < 0.01; ***, P < 0.005; §§, P < 0.0005; §§§, P < 0.0001).





Supporting Figure 13

Fig. 13. SEMA5A expression in mammary gland. Results are means of quantity relative to cured quarter. Yellow and green bars indicate the mean ± SEM (n = 21 and 33, respectively) from cattle with unknown status. Red and blue bars indicate the mean (n = 3) from cattle with mastitis. Asterisks denote statistically significant results as determined by Student’s t test (*, P < 0.05; **, P < 0.01).





Supporting Figure 14

Fig. 14. Candidate genes induced by SEMA5A whose average signal log ratio exceed 3 and GO biological process include chemotaxis and inflammatory/immune response.