Sugimoto et al. 10.1073/pnas.0601015103. |
Supporting Figure 5
Supporting Figure 6
Supporting Figure 7
Supporting Figure 8
Supporting Figure 9
Supporting Figure 10
Supporting Figure 11
Supporting Figure 12
Supporting Figure 13
Supporting Figure 14
Fig. 5. Distribution of SCS in families in the QTL study.
Fig. 6. The maximum LOD score on each chromosome obtained by the first screening.
Fig. 7. Alignment of predicted amino acid sequences of cattle (12G, AY644769; 13G, AY644770), human (NP_060478), and mouse (NP_536681) FEZL. A yellow box indicates a glycine stretch, and blue arrows indicate six C2H2 type zinc-finger domains.
Fig. 8. Transfected V5-tagged FEZL stained by fluorescein isothiocyanate (green) is localized in the nucleus stained by 4', 6-diamidino-2-phenylindole (blue). The scale bar indicates 8 mm.
Fig. 9. Consensus binding sequence. Checked boxes indicate sequences bound with 13G FEZL and others bound with 12G FEZL.
Fig. 10. Gel mobility shift assay with a consensus site (AGCAGAAGCAGAAGCAGA) and AP2 (GATCGAACTGACCGCCCGCGGCCCGT).
Fig. 11. FEZL binding sequences whose BLAT scores exceed 100. Black bars indicate exons, and a green bar includes the start codon in diagram of SEMA5A gene.
Fig. 12. FEZL, SEMA5A, TNF-a, and IL-8 expressions in OCUB-M cells transfected with siRNAs. Results are means ± SEM (n = 9; three experiments) of quantity relative to OCUB-M cells transfected without constructs. Symbols denote statistically significant results as determined by Students t test (**, P < 0.01; ***, P < 0.005; §§, P < 0.0005; §§§, P < 0.0001).
Fig. 13. SEMA5A expression in mammary gland. Results are means of quantity relative to cured quarter. Yellow and green bars indicate the mean ± SEM (n = 21 and 33, respectively) from cattle with unknown status. Red and blue bars indicate the mean (n = 3) from cattle with mastitis. Asterisks denote statistically significant results as determined by Students t test (*, P < 0.05; **, P < 0.01).
Fig. 14. Candidate genes induced by SEMA5A whose average signal log ratio exceed 3 and GO biological process include chemotaxis and inflammatory/immune response.