Genome-wide RNAi screen of Ca2+ influx identifies genes that regulate Ca2+ release-activated Ca2+ channel activity -- Zhang et al. 103 (24): 9357 Data Supplement - HTML Page - index.htslp -- Proceedings of the National Academy of Sciences

Zhang et al. 10.1073/pnas.0603161103.

Supporting Information

Files in this Data Supplement:

Supporting Table 1
Supporting Table 2
Supporting Figure 6
Supporting Figure 7
Supporting Figure 8
Supporting Table 3
Supporting Figure 9
Supporting Materials and Methods
Supporting Table 4

Supporting Figure 6

Fig. 6.
Validation of effective mRNA overexpression or knockdown. RT-PCR analysis was performed as described in Supporting Materials and Methods using gene-specific primers (see Table 4). (A) Overexpression of olf186-F. (B) Suppression of Ca-P60A. (C) Suppression of Syx5. (D) Suppression of tsr.

Supporting Figure 7 Fig. 7.
Biophysical and pharmacological properties of enhanced CRAC current after olf186-F + Stim cotransfection. (A) Time course of currents with 2 mM external Ca²⁺, and during subsequent exposure to divalent-free Na⁺- or Cs⁺-containing solution. Arrows indicate the time points for current–voltage curves presented in B. (B) Corresponding Ca²⁺, Na⁺, and Cs⁺ current–voltage relations. (C) Ca²⁺ currents in response to voltage pulses ranging from –130 to +90 mV in 10-mV increments from the holding potential of –10 mV. (D) Corresponding current–voltage curves (not leak subtracted) at beginning (squares) and end (circles) of pulses. (E) Effect of 2-APB at indicated concentrations. (F) Gd³⁺ reversibly blocks the Ca²⁺ current.

Supporting Figure 8 Fig. 8.
olf186-F is a member of a conserved gene family. (A) Phylogram of olf186-F family. Homologous proteins of the Drosophila olf186-F gene product were searched with PHI-BLAST. Hs, human; Mm, mouse; Rn, rat; Cf, dog; Gg, chicken; Dr, zebrafish; Dm, fly; Ce, worm. There are three conserved gene subfamilies within mammals. (B) Kyte–Doolittle hydropathy plot (window = 11 residues) of the Drosophila olf186-F gene product. The y axis represents hydrophobicity, and the x axis represents the 351-aa linear polypeptide sequence. The four putative transmembrane segments represented in fly and human homologs are designated S1–S4; S0 indicates an additional predicted a-helical structure found uniquely in the fly sequence. (C) Diagram of predicted transmembrane topology and sequence of Drosophila olf186-F. Positively charged residues are shown in blue, negatively charged residues are red, and conserved histidines are green. Residues that are identical in fly and three human homologs are shown enlarged and bold.

Supporting Figure 9 Fig. 9.
Genome-wide RNAi screen for SOC influx. (A) Schematic diagram showing the screening protocol and timeline. (B) Scatter plot for the duplicate genome-wide screens. The two "CCE/basal" values derived for each amplicon are plotted on the x and y axes to show the overall reproducibility. (C) The z-score was derived from the averaged CCE/basal value of each well. All dsRNAs that inhibited TG-evoked calcium entry with a z-score of < –3 (lower dashed line) were selected as hits for further analysis.

Table 1. Top 10 hits involved in store-operated Ca²⁺ entry

DRSC amplicon	Target gene	CCE/ basal	basal/F_max	Z of F_max	Predicted TM segments	Putative function	Potential off-targets
DRSC11164	Ets65A	1.16	0.23	–0.35	0	Transcription factor	0
DRSC04600	Ca-P60A	1.23	0.37	0.43	8	SERCA pump	0
DRSC20158	Stim	1.26	0.28	–1.03	1	Putative ER Ca²⁺ sensor for SOC activation	0
DRSC04718	tsr	1.28	0.37	0.56	0	Actin binding protein	0
DRSC02708	cdc23	1.30	0.35	–1.69	0	Component of anaphase-promoting complex for mitotic anaphase	1
DRSC22061	olf186-F	1.31	0.29	–1.11	4	Drosophila CRAC candidate	0
DRSC04558	dom	1.32	0.35	0.38	0	Component of chromatin remodeling complex for DNA recombination	0
DRSC03256	Sec61alpha	1.32	0.41	1.40	10	Component of translocon complex for protein trafficking	0
DRSC03432	Syx5*	1.33	0.33	–2.21	1	t-SNARE protein for vesicle fusion	0
DRSC18760	deltaCOP	1.34	0.32	–1.39	0	Component of COPI complex for protein trafficking	0

DRSC, Drosophila RNAi Screening Center at Harvard University.

Table 2. Group 3 hits, decreased CCE

DRSC amplicon	Target gene	CCE/ basal	Basal/F_max	Z of F_max	Potential off-targets
DRSC00777	Rab5	1.41	0.40	2.98	1
DRSC02278	CG13773	1.45	0.40	–1.48	0
DRSC03611	smt3	1.36	0.37	–1.69	0
DRSC03342	Hel25E	1.40	0.30	–1.08	0
DRSC03574	mts	1.36	0.28	0.43	0
DRSC03080	Pvr	1.37	0.39	–1.58	0
DRSC03256	Sec61alpha	1.32	0.41	1.40	0
DRSC02179	CG12750	1.35	0.31	–1.91	0
DRSC02708	cdc23	1.30	0.35	–1.69	1
DRSC04600	Ca-P60A	1.23	0.37	0.43	0
DRSC04558	dom	1.32	0.35	0.38	0
DRSC08370	CG13900	1.47	0.29	–1.74	0
DRSC07000	Bap55	1.54	0.28	2.89	0
DRSC07659	pAbp	1.38	0.34	–1.75	0
DRSC06044	DMAP1	1.54	0.31	1.42	0
DRSC11164	Ets65A	1.16	0.23	–0.35	0
DRSC11032	CG8743	1.50	0.34	2.95	0
DRSC11257	Prosbeta2	1.52	0.33	–1.55	0
DRSC11124	CycT	1.47	0.33	–1.66	4
DRSC12536	CG1249	1.54	0.27	–1.65	0
DRSC15625	CG4699	1.55	0.32	–0.17	0
DRSC15948	CG6015	1.55	0.30	–1.53	0
DRSC15166	CG16941	1.53	0.28	–1.67	0
DRSC16034	Dis3	1.42	0.30	–1.52	0
DRSC16839	Rpn2	1.41	0.33	–1.87	0
DRSC18760	deltaCOP	1.34	0.32	–1.39	0
DRSC18360	APC4	1.54	0.36	–0.27	0
DRSC20158	Stim	1.26	0.28	–1.03	0
DRSC00782	RpL40	1.58	0.31	–1.28	0
DRSC03261	CG9548	1.58	0.30	–1.55	0
DRSC02680	CG18591	1.61	0.28	–1.78	0
DRSC02721	Vha68-2	1.64	0.32	0.31	0
DRSC02868	Pect	1.65	0.28	1.74	0
DRSC04718	tsr	1.28	0.37	0.56	0
DRSC04884	Nipped-A	1.54	0.36	–1.17	0
DRSC04838	Bub1	1.59	0.36	–1.38	0
DRSC06417	MrgBP	1.56	0.34	–1.42	0
DRSC06421	CG30349	1.59	0.32	–1.73	0
DRSC07501	Pabp2	1.42	0.31	–1.50	0
DRSC07408	E(Pc)	1.48	0.34	2.04	0
DRSC07575	RacGAP50C	1.62	0.26	2.70	0
DRSC07583	betaTub56D	1.55	0.34	–1.91	2
DRSC07502	hrg	1.53	0.36	0.77	0
DRSC08730	pav	1.55	0.34	1.31	1
DRSC10696	CG6694	1.58	0.31	–1.59	0
DRSC09740	sti	1.50	0.27	0.48	0
DRSC11079	CG9598	1.69	0.34	1.36	0
DRSC11330	brm	1.54	0.33	–1.38	0
DRSC11663	CG11451	1.52	0.34	–1.10	0
DRSC12351	Gnf1	1.57	0.35	–1.49	0
DRSC12623	alphaTub84D	1.45	0.35	–1.52	2
DRSC14371	CG31258	1.53	0.32	–1.50	0
DRSC16555	bel	1.56	0.30	3.39	3
DRSC16899	alphaTub85E	1.39	0.37	–0.46	3
DRSC16940	eff	1.41	0.33	–1.60	0
DRSC16808	Rab1	1.40	0.34	–1.50	0
DRSC16938	eIF-3p66	1.41	0.36	–1.65	0
DRSC16704	Hmgcr	1.44	0.36	–1.26	0
DRSC16920	cdc16	1.46	0.38	–0.89	0
DRSC18483	Roc1a	1.64	0.31	–1.32	0
DRSC18713	Rpt4	1.37	0.34	–0.97	0
DRSC19385	CG11138	1.50	0.30	–0.21	3
DRSC19570	CG14214	1.51	0.33	–0.69	1
DRSC21306	xmas-2	1.63	0.35	–1.55	0
DRSC05281	E(Pc)	1.56	0.34	3.86	0
DRSC09005	dpr6	1.47	0.29	–1.54	2
DRSC09132	CycA	1.57	0.29	1.24	0
DRSC04725	zip	1.59	0.26	1.58	0
DRSC18419	dalao	1.66	0.28	0.49	0
DRSC21641	CG40127	1.52	0.28	1.71	0
DRSC21554	Syx1A	1.59	0.30	0.04	0
DRSC21831	swm	1.66	0.29	–1.12	0
DRSC22061	olf186-F	1.31	0.29	–1.11	0
DRSC22489	zip	1.64	0.26	3.28	0
DRSC23010	Atx2	1.49	0.33	0.63	0

DRSC, Drosophila RNAi Screening Center at Harvard University.

Table 3. Solutions for Ca²⁺ imaging and whole-cell recording

Name	Na⁺	K⁺	Ca²⁺	Mg²⁺	Cl^-	HEPES	pH	Osmolality
S2 Ringer (Ca2)	150	5	2	4	167	10	7.2	328
Ca²⁺-free S2 Ringer (Ca0)	150	5	–	6	167	10	7.2	332
S2 external (Ca2)	160	–	2	–	164	10	6.6	325
High-Ca²⁺ S2 external (Ca20)	124	–	20	–	164	10	6.6	324
Divalent free Na⁺ (Na)	152	–	–	–	152	10	6.6	328
Divalent free Cs⁺ (Cs)	160	–	–	–	164	10	6.6	324
Name	Cs⁺ aspartate		CsCl	Mg²⁺ gluconate		HEPES	pH	Osmolality
S2 internal	133		2	8		15	7.2	320

Solution names used in figures are indicated in bold. Ringer solutions were used for [Ca²⁺]_i imaging; external solutions were used in patch-clamp experiments. Concentrations are in mM, and osmolality is in mOsm/kg. S2 Ringer solutions contained 2.5 mM probenecid. Ca²⁺-free Ringer and external solutions contained 1 mM EGTA. All Ringer and external solutions contained 10 mM d-glucose. High-Ca²⁺ external solution contained 10 mM sucrose. Internal solutions contained 12 mM BAPTA. pH was adjusted with the appropriate hydroxide.

Table 4. Primers

Gene	Primer	Primer sequence 5' to 3'
Drosophila dsRNA primers (T7 sequence underlined)
olf186-F	olf186-F-RNAi F1	GAATTAATACGACTCACTATAGGGAGA ATACGAATGTACCACCGGG
olf186-F	olf186-F-RNAi R1	GAATTAATACGACTCACTATAGGGAGA CCAAGTGATGCTAGACAATGT
Cloning primers
olf186-F	olf186-F-clone F1	CTGAACATGAAGCGGCCGCATCATGTCTGTGTGGACCAC
olf186-F	olf186-F-clone R1	GCTGAACTCGAGCTAGACAATGTCCCCGGATG
RT-PCR primers
olf186-F	olf186-F-RT F1	GAATTAATACGACTCACTATAGGGAGA ATACGAATGTACCACCGGG
	olf186-F-RT R1	GAAAGAGTATGAGTCCCAGC
	olf186-F-RT F2	CCAACAATTCGGGCCTAGAGAC
	olf186-F-RT R2	GTAGGTGGGCGAGTGGAGATC
Stim	Stim-RT F1	CAGTGGAAGTGTTCAGGATCGC
Stim	Stim-RT R1	CCACATCCATTGCCTTCAATGAG
CG11059	CG11059-RT F1	CTCGCCTAGACTTATGTGAC
CG11059	CG11059-RT R1	CCAGTAGACCCATCAAAGTG
Presenilin (Psn)	PSN -RT F1	CTACGGAGGCGAACGAACG
Presenilin (Psn)	PSN-RT R1	GGCGATTGTTCATGGAAAGG
Ca-P60A	CaP60A-RT F1	CGATATCCGTATCACCCACA
Ca-P60A	CaP60A-RT R1	CTCACCGAACTCGTCCAGTT
Syntaxin 5 (Syx5)	Syx5-RT F1	CGCTTCCATTCCGACTAGTT
Syntaxin 5 (Syx5)	Syx5-RT R1	GCTTCTCCAGTTTTGCGTAG
tsr	Tsr-RT F1	GAAATGCGGACCTGGAGAGT
tsr	Tsr-RT R1	CGACTTCTTGAGAGCATCGA

Supporting Materials and Methods
Cell Culture and Transfection.
Drosophila S2 cells (Invitrogen) used in the RNAi screen, single cell imaging, and patch–clamp experiments were propagated in Schneider’s medium (Invitrogen) supplemented with 10% FBS (Invitrogen) at 24°C. Cells were seeded at a density of 10⁶ cells per ml and passaged when the cells achieved a density of »6 × 10⁶ cells per ml. S2 cells were transfected (see clones described later) using a Nucleofector (Amaxa, Gaithersburg, MD) following the manufacturer’s protocol. Forty-eight hours after transfection, cells were used for patch–clamp experiments or processed for RT-PCR analysis. Molecular Cloning.
A cDNA clone, pAc5.1/olf186-F, encoding full-length Drosophila olf186-F-RB, was generated for transfection into S2 cells. Briefly, a 1.1-kb fragment was isolated from total mRNA of Drosophila S2 cells by RT-PCR and subcloned between the XhoI and NotI sites of pAc5.1/V5-His B expression vector. Primers were designed based on the deposited flybase sequence of olf186-F (CG11430RB). Resulting clones were sequenced (GenBank accession no. DQ503470). Generation of pAc5.1/EGFP and pAc5.1/D-STIM were as described in ref. 1. Preparation of dsRNA for Validation at Single-Cell Level.
PCR templates for dsRNA synthesis were either from the Drosophila RNAi Screening Center (DRSC) stock or were analyzed by RT-PCR from cultured S2 cells (olf186-F). Primers were designed based on the original amplicon sequences to produce »500-bp fragments with T7 polymerase binding sites on both sense and antisense strands. For PCR primer pairs, see Table 4. The MEGAscript RNAi kits (Ambion, Austin, TX) were used to synthesize the dsRNA according to manufacturer’s protocol. The concentration of dsRNA was determined by optical density at 260 nm. RNAi in Drosophila S2 Cells.
RNAi experiments were adapted from the protocols described by Worby et al. (2). Drosophila S2 cells (0.5 × 10⁶) were seeded in T-25 flasks in 2 ml of complete S2 medium. The next day, medium was removed and replaced with 2 ml of serum-free S2 medium. Twenty micrograms of dsRNA was added, and cells were incubated at room temperature for 45 min with gentle rocking. Four milliliters of S2 medium was added, and cells were incubated for 5 days at 24°C. Cells then were harvested and either plated for single-cell Ca²⁺ imaging and patch–clamp experiments or processed for RT-PCR analysis. RNA Isolation and RT-PCR.
RNA was isolated using TRIzol (Invitrogen) following the manufacturer’s protocols. The total RNA yield was calculated from the OD₂₆₀ of the RNA preparation. RNA quality was determined from the absorbance ratio OD₂₆₀/OD₂₈₀ (>1.8). In each sample, total RNA (3 mg) was reverse-transcribed using the Superscript Preamplification System (Invitrogen). The sense and antisense primers were specifically designed from the coding regions of our targeted genes (Table 4). The fidelity and specificity of the sense and antisense oligonucleotides were examined using the BLAST program. PCR reactions were performed by DNA thermal cycler (Bio-Rad) using Platinum PCR Supermix High Fidelity (Invitrogen). The first-strand cDNA reaction mixture (1 ml) was used in a 50-ml PCR reaction consisting of 0.2 mM paired primers. The cDNA samples were amplified under the following conditions: the mixture was denatured at 94°C (30 s), annealed at 55°C (30 s), and extended at 68°C (30 s) for 25-27 cycles, followed by a final extension at 72°C (10 min) to ensure complete product extension. The PCR products were electrophoresed through a 1.5% agarose gel, and amplified cDNA bands were visualized by GelStar (Cambrex, East Rutherford, NJ) staining. Single-Cell [Ca²⁺]_i Imaging.
Ratiometric [Ca²⁺]_i imaging was performed as described in ref. 3, using solution recipes described in Table 3. Transfected cells were recognized by coexpressed enhanced GFP (EGFP), using filters to avoid contamination of Fura-2 fluorescence by bleedthrough of GFP fluorescence (4). Data were analyzed with METAFLUOR software (Universal Imaging, Downington, PA) and ORIGINPRO 7.5 software (OriginLab, Northampton, MA) and are expressed as means ± SEM. Whole-Cell Recording.
Patch–clamp experiments were performed at room temperature in the standard whole-cell recording configuration, as described in ref. 5, using a holding potential of –10 mV. The recipes of external and internal solutions are indicated in Table 3. The membrane capacitance (a measure of cell surface area) of S2 cells selected for recording was 9.15 ± 0.27 pF (mean ± SEM, n = 287 cells, 22 experiments). To calculate current densities, peak current amplitudes were divided by membrane capacitance for each cell. Liquid junction potentials were re-evaluated, resulting in a corrected P_Cs/P_Na of 0.17, instead of 0.08 (5), for both native CRAC current and current induced by coexpression of olf186-F and Stim. Bioinformatics.
The PHI-BLAST server at the National Center for Biotechnology Information was used to look for homologous proteins of the Drosophila olf186-F gene product. The criteria used were: E value < 1 ´ 10^–20, and the length of homology regions must be at least 2/3 of the full proteins. The sequences of all family members identified were clustered using CLUSTALW, and a phylogenetic tree (phylogram) was generated according to the mutual similarity among the members.

1. Zhang, S. L., Yu, Y., Roos, J., Kozak, J. A., Deerinck, T. J., Ellisman, M. H., Stauderman, K. A. & Cahalan, M. D. (2005) Nature 437, 902–905.

2. Worby, C. A., Simonson-Leff, N. & Dixon, J. E. (2001) Sci. STKE 2001, PL1.

3. Roos, J., DiGregorio, P. J., Yeromin, A. V., Ohlsen, K., Lioudyno, M., Zhang, S., Safrina, O., Kozak, J. A., Wagner, S. L., Cahalan, M. D., et al. (2005) J. Cell Biol. 169, 435–445.

4. Fanger, C. M., Rauer, H., Neben, A. L., Miller, M. J., Wulff, H., Rosa, J. C., Ganellin, C. R., Chandy, K. G. & Cahalan, M. D. (2001) J. Biol. Chem. 276, 12249–12256.

5. Yeromin, A. V., Roos, J., Stauderman, K. A. & Cahalan, M. D. (2004) J. Gen. Physiol. 123, 167–182.